INTRODUCTION
Leishmaniasis is one of the nine emerging individual infectious diseases that have been largely neglected around the world and in the Middle East1.
In Iran, leishmaniasis is observed in three clinical forms: zoonotic cutaneous leishmaniasis (ZCL), anthroponotic cutaneous leishmaniasis (ACL) and zoonotic visceral leishmaniasis (ZVL). ZCL caused byLeishmania major has a health as well as socioeconomic impacts in Iran. ZCL has been reported in rural regions of Iran in 15 of 31 Provinces,including: Bushehr, Hormozgan and Fars in the south2,3; Ilam and Khuzestan in the southwest and west4,5; Golestan, Khorasan and Semnan in the northeast and north4–6; and Isfahan in the central region7.
During the life cycle of ZCL, which depends on the geographical location of the disease, sandflies act as vectors of Leishmania, Bartonella bacilliformis and some arboviruses, and wild rodents are considered to be the reservoir hosts8. Many investigations have been conducted on different aspects of ZCL in naturally important foci in Iran9–11, although some areas of neighboring Provinces have been neglected for unknown reasons. Predisposing factors, such as increasing migration of patients from endemic foci to potential areas, irregular construction and urbanization and changing sandfly fauna in the region affect the distribution and survival of ZCL9,12.
Yazd Province in central Iran is one of these regions, and the number of cases of ZCL has been increasing since 198110. The official reports from the health center in Yazd Province has demonstrated that the number of cases of CL in the Ardakan area (which is an important potential focus in southwestern Yazd) increased from 1996 to 1997 (total: 372 cases), which may lead to monitoring and surveillance activities in this district13. A few studies have examined some cities in Yazd Province (Ardakan, Taft, Bafgh, and Khatam cities); however, no molecular-epidemiologic investigations have been performed in Abarkouh district yet. Abarkouh has many historical places (such as Abarkouh’s Cedar) and tourism values therefore, tourists play an important role in spreading the infection to other Provinces. Thus, the isolation, detection and identification of Leishmania spp. in rodents are essential for disease prognosis, diagnosis methods, the monitoring of clinical outcomes, epidemiological perspectives and treatment program planning. Some reports have demonstrated that Rhombomys opimus and Meriones libycus are the most important reservoir hosts of ZCL in the neighboring Provinces of Isfahan and Shiraz14,15. The geographical distribution of reservoir hosts of ZCL in different regions of Iran is shown in Figure 111.
For population genetic studies and species identification, we utilized the cytochrome b gene of rodents, cytochrome b(Cyt b) of Leishmania, ITS1-5.8S ITS2 ribosomal deoxyribonucleic acid (rDNA), kinetoplast deoxyribonucleic acid (kDNA) and microsatellite deoxyribonucleic acid (DNA) genes were employed for detection of any Leishmania infection. Low intracellular polymorphism and readable sequences are important advantages of internal transcribed spacer-ribosomal deoxyribonucleic acid (ITS-rDNA) in molecular identifications7,16–18. The kinetoplast in Trypanosomatidae contains nearly 10,000 small circular DNAs (kDNA minicircle). This minicircle comprises a variable region (600bp) and a conserved region (120bp). Microsatellite markers in Leishmania parasites are co-dominant and allelic and combine 1-7 nucleotide units into short, tandemly repeated DNA sequences19,20. Currently, multilocus microsatellite typing (MLMT) is being used widely in population genetic studies in different species of Leishmaniaparasites21,22. Minicircle kDNA and microsatellite ITS-rDNA are also well known as molecular markers for the detection of Leishmaniainfections7,21.
The Cyt b gene encodes the central catalytic subunit of an enzyme present in the respiratory chain of mitochondria and exists in almost all organisms. This gene has been broadly used for phylogenetic studies and identification of animals and plants23. The Cyt b gene of the genus Leishmania consists of two regions: the edited region (the most 5′ region of 23bp), which undergoes ribonucleic acid (RNA) editing, and the non-edited region (the 3′ region of 1,056bp)23.
Since the rodent fauna, the Leishmania species and their infection rate in Abarkouh district of Yazd Province, Iran, haves not been elucidated completely; we have designed this study in order to investigate these aspects of ZCL.
METHODS
Study area, sampling and laboratory methods
This cross-sectional/descriptive study was performed in 2011 and 2012, and rodent samples were obtained from 5 villages across Abarkouh district, Yazd Province, central Iran, including: Abarghasr, Haroni, Khorram abad, Gonabad and Chahgir.
Abarkouh district is situated between Fars (southern Iran) and Isfahan (central Iran) Provinces (Figure 1). These Provinces are considered hyper-endemic regions that are important sites for ZCL7. Abarkouh district, with an altitude of 1,510 meters above sea level (a.s.l.) (4,954 feet), geographic coordinates of ″31°07′44″N 53°16′57″E31.13°N 53.28°E″ (Figure 1) and a population of approximately 21,818 people, is located in Yazd Province in central Iran. Due to its hot and dry climate and its proximity to Isfahan and Fars Provinces, Abarkouh is considered a new and emerging focus of ZCL as well.
The rodents were sampled in Abarkouh area 120km southwest of Yazd Province, using wooden and wire traps. To identify active colonies of rodents within a diameter of 1-1.5km around villages in Abarkouh, approximately 30-40 live traps were used, and the rodents were captured monthly by baiting with dates and cucumbers. The genus and species of each rodent were determined based on external features, including: ears, color, tail, body measurements, teeth, feet and cranium15,24,25.
Each protocol and method applied in this survey was conducted according to the principles expressed in the Declaration of Helsinki and was approved by the Human and Animal Research Ethics Committee of the Pasteur Institute of Iran.
Two impression touch slides were obtained from both ears of each rodent by scratching. For brief microscopic observation, rodent samples were collected from the ears after removing the hair and making small scratches from which to extract serous fluid, which was then fixed on a microscopic slide with methanol and stained for 30min with Giemsa diluted 1:10. The slides were then observed under a light microscope to detect the presence of Leishman bodies.
Furthermore, serous fluid from the rodents’ ears was injected into Balb/C mice to monitor for the appearance of Leishmania infection lesions. Prepared serous fluid from infected Balb/C mice accompanied by serous fluid from scratches from each ear of rodents was cultured in Novy-MacNeal-Nicolle (NNN) medium. Subsequently, the cultures were incubated at 22°C for 6 weeks. The cultures were checked at two-day intervals until they reached the growth phase (log phase) based on observation using an inverted microscope. Positive cultures were confirmed by the presence of promastigotes, which were sub-cultured into restriction fragment length polymorphism (RFLP) medium weekly.
The harvested promastigotes from the early stationary phase (approximately 2×106 promastigotes/ml) and serous fluid from each ear of the rodent were injected subcutaneously into the base tail of a Balb/C mouse. Inoculated Balb/C mice were examined weekly for the appearance of lesions at the injection site for 6 months. Samples from infected Balb/C mice with cutaneous lesions were used for DNA extraction.
Molecular methods
Smears prepared from infected Balb/C mice, with serous fluid and/or cuts from each rodent ear, were kept in separate 1.5ml microtubes containing 100µl phosphate-buffered saline (PBS) and then centrifuged briefly three times at 13,000rpm. The PBS was discarded. Each rodent ear was placed in a 1.5ml microtube and placed in liquid nitrogen 3 times for 3min each. The genomic DNA of each rodent and any parasite within was extracted using the ISH-Horovize method and a GeNet BIO kit (Global Gene Network South Korea); these procedures were carried out in the systematic molecular laboratory of the Pasteur Institute in a room where amplified and cloned DNAs were never processed11,25.
The DNA samples extracted from rodent tissues were used in polymerase chain reaction (PCR) to amplify a 624bp fragment of the cytochrome b gene (Cyt b) from the mitochondrial DNA to accurately identify the rodent species. We followed the protocol of Kent and Norris (Table 1)26.
Genes | Primer name | Primer sequence | Fragment size (bp) | Annealing temperature & cycle number | |
---|---|---|---|---|---|
ITS-rDNA | ITS1F (F) | 5′ GCAGCTGGATCATTTTCC 3′ | 462 | 58°C, 37 | |
ITS2R4 (R) | 5′ ATATGCA GAA GAGAGG AGG C 3′ | ||||
Microsatellite DNA | ITSmF1 (F) | 5′ GTGTGGAAGCCAAGAGGAGG 3′ | 160 | 58°C, 37 | |
ITSmR2 (R) | 5′ GCAAGCACCAGAGAGGAGT 3′ | ||||
kDNA | LINR4 (F) | 5′ GGGGTTGGTGTAAAATAGGG 3′ | Semi-nested PCR | 1st step: 52°C, 17 | |
LIN 17 (first-step R) | 5′ TTTGAACGGGATTTCTG 3′ | 650 | |||
LIN19 (second-step R) | 5′ CAGAACGCCCCTACCCG 3′ | 2nd step: 58°C, 33 | |||
LeishmaniaCytochrome b | LCBF1 (F) | 5′ GGTGTAGGTTTTAGTTTAGG 3′ | 880 | 50°C, 39 | |
LCBR2 (R) | 5′ CTACAATAAACAAATCATAATATACAATT 3′ | ||||
Rodent Cytochrome b* | UNFOR403 (F) | 5′ TGAGGACAAATATCATTCTGAGG 3′ | 624 | 58°C, 35 | |
UNREV1025 (R) | 5′ GGTTGTCCTCCTCCAATTCATGTTA 3′ |
Bp: Base pairs; ITS-rDNA: internal transcribed spacer-ribosomal deoxyribonucleic acid; DNA:deoxyribonucleic acid; kDNA:kinetoplast deoxyribonucleic acid; (F): Forward primer; (R): Reverse primer;
*Rodent cytochrome b genes were not used for the detection of Leishmania infection but only for rodent species identification.
The internal transcribed spacer-ribosomal deoxyribonucleic acid gene was amplified for the detection of Leishmania infection using ITS1-5.8SrRNA-ITS2 fragments, with ITS1F as the forward primer and ITS2R4 as the reverse primer (Table 1)7.
To perform RFLP analysis, the PCR products were blunt digested using endonuclease BsuR1 (HaeIII) (Fermentas, Life Sciences, Germany) in the recognition site pattern GG↓CC, as recommended by the manufacturer. Enzyme selection was performed by analyzing sequences of Leishmania reference species with CLC DNA Workbench 5.2 software (CLC bio A/s, Aarhus, Denmark)27.
The primer sets LINR4 (forward), LIN17 (first-step reverse) and LIN19 (second-step reverse) were used in the semi-nested PCR for the minicircle kDNA gene16. The primers anneal within the conserved area of the minicircle and are based on the conserved sequence blocks recognized by Brewster and Baker (Table 1)28.
The third method used for Leishmania infection identification was microsatellite ITS-rDNA analysis; the protocol used in this assay was designed by Parvizi et al.25. The primers were ITSMF1 (forward) and ITSMR2 (reverse) (Table 1).
To detect Leishmania infection, we also used a fragment of the cytochrome b gene from mitochondrial DNA, and the primers used in this amplification were LCBF1 (forward) and LCBR2 (reverse) (Table 1)17.
After amplification, the DNA samples were excised, purified and sequenced using an ABI PRISM TM310 automated sequencer (Applied Biosystems, USA). The sequences obtained were edited and aligned with database sequences using SequencherTM v. 4.4 software to identify unique sequences (= haplotypes), which were analyzed phylogenetically using MEGA5.05 software29,30.
RESULTS
In total, 68 rodents were captured in five villages in Abarkouh district (Figure 1; Table 2). Thirty-three of 68 rodents were alive and transported to the Pasteur Institute of Iran, Tehran, for further studies using conventional and molecular methods. Thirty-five rodents were dead after being caught by wire and wooden live traps at sampling sites. The ears of these dead rodents were used only for molecular methods. Based on morphological characteristics and rodent molecular markers (Cyt bsequences), five species were identified. The most abundant rodent was R. opimus (55/68: 81%). The frequencies and abundances of the other rodent species were as follows: M. libycus(8/68: 12%), Meriones persicus (2/68: 3%), Tatera indica (2/68: 3%) and Mus musculus (1/68: 1%), respectively (Table 2).
Villages | Conventional methods | Molecular methods | Total | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Species | Frequency of captured rodents | Harooni | Abarghasr | Khoram abad | Gonbad | Chahgir | Microscopic Observation of Leishmaniaparasites | BALB/C Injection | Leishmania major (+ve) by ITS-rDNA PCR | Leishmania major (+ve) by microsatellite PCR | Leishmania major (+ve) by kDNA PCR | Leishmania major (+ve) byLeishmaniaCyt b PCR | |
Rhombomys opimus | 81% | 0/10 | 0/10 | 1/4 | 8/26 | 0/6 | 1/55 | 1/55 | 2*/55 | 8(3*)/55 | 2(1*)/55 | 3*/55 | 9* / 55 (13.04%) |
Meriones libycus | 12% | 0 | 0 | 0/1 | 0/3 | 1/4 | 1/8 | 1/8 | 1/8 | 1**/8 | 1**/8 | 1**/8 | 1/8 (12.5%) |
Mus musculus | 1% | 0 | 0 | 0 | 0 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 | 0/1 (0%) |
Meriones persicus | 3% | 0 | 0 | 0 | 0/1 | 0/1 | 0/2 | 0/2 | 0/2 | 0/2 | 0/2 | 0/2 | 0/2 (0%) |
Tatera indica | 3% | 0 | 0 | 0 | 0 | 1/2 | 0/2 | 0/2 | 0/2 | 1/2 | 1*/2 | 0/2 | 1/2 (50%) |
Total | 100% | 0/10 (0%) | 0/10 (0%) | 1/5 (20%) | 8/30 (27%) | 2/14 (14%) | 2/68 (2.94%) | 2/68 (2.94%) | 3/68 (4.4%) | 10 /68 (14%) | 3/68 (4.4%) | 4/68 (5.8%) | 11 /68 (16%) |
ITS-rDNA: internal transcribed spacer-ribosomal deoxyribonucleic acid; kDNA: kinetoplast deoxyribonucleic acid. +ve: Positive sample; PCR: polymerase chain reaction; Cyt b: Cytochorome b.
*3 of 13 positive samples were also tested via one additional gene and were confirmed to have Leishmania majorinfection;
**The positive microscopic and BALB/C injected samples also tested positive in molecular tests (ITS-rDNA, microsatellite and kDNA gene amplification).
Eleven of 68 (16%) rodents were found to be infected with Leishmania parasites using molecular methods (3/68 (4.4%) using ITS-rDNA, 10/68 (14%) using microsatellites, 3/68 (4.4%) using minicircle kDNA and 4/68 (5.8%) by amplifying Cyt b from Leishmania parasites). At least 3 of 5 rodent species had Leishmaniainfections (Figure 2). Only two of 33 (6.06%) live rodents were found to be Leishmaniapositive using conventional methods, including impression touch smears from the ear, light microscope observation, culturing in NNN and inoculating in Balb/C mice (Table 2).
The most interesting result was that despite the low number of captured rodents, five different rodent species were collected and identified. Leishmania infection was detected from three of these species, and for the first time, T. indica was captured in Abarkouh district and identified both morphologically through diagnostic keys and molecularly by sequencing of the Cyt b gene. In addition, one of the two T. indicaspecimens was infected with L. major.
To find identify additional Leishmania parasite infections and molecular variation rates among collected samples, different genes were employed. Standard and semi-nested PCR were used to amplify ITS-rDNA, microsatellites, kDNA and Cyt b genes from Leishmania parasites (Figure 2).
All 11 Leishmania-positive samples were analyzed using RFLP and sequencing to definitively identify Leishmania species (Figure 2). With RFLP, which allows for the differentiation of each species unambiguously, two fragments of 120 and 310bp belonging to L. major were obtained (Figure 2).
All sequences from positive samples by ITS-rDNA gene were blasted and confirmed to be most similar to L. major, and only L. major with one common haplotype (GenBank accession No. EF413075) was found after direct sequencing, editing, aligning and comparing with the sequences submitted to GenBank using Sequencher TM v. 4.4 and phylogenetic analysis by MEGA5.05 software.
DISCUSSION
In our study, only the L. major parasite with one common haplotype (GenBank access No. EF413075) was firmly identified in three rodent species. Leishmania parasites have been isolated from all three species in other ZCL foci in Iran11,15,25,31. This is the first report of L. major in only a small area of ZCL focus in Abarkouh. In our current publication, we also found L. major in P. papatasi, a proven vector of ZCL in Iran, in the same area in Abarkouh where L. major was isolated in rodents7,10,32.
Finding additional Leishmania infections in different rodent species compared with only one sandfly species can be explained by the fact that among sandflies, we mainly examined P. papatasi, and only a small number of other sandfly species were tested and found to be Leishmania negative, which did not provide sufficient for a precise result10. In addition, only P. papatasi is able to develop L. major in its midgut and transfer the parasite to salivary glands to cause ZCL33. However, we analyzed all the captured rodent samples from different species, and therefore, we were able to identify Leishmania infections in at least three rodent species. The Leishmania infection rate in rodents as the reservoir host of ZCL is much higher than in sandflies as vectors, and in some cases, more than 50% of the samples were found to be infected with Leishmaniaparasites14.
Based on our experience in different ZCL foci in Iran, we expected to identify more Leishmania infections in reservoir hosts in Abarkouh district and to observe at least a small amount of variation in the ITS-rDNA gene of L. major in rodents. However, only one haplotype was found, and approximately 16% (11/68) of the tested rodents were infected with Leishmania parasites11,15,25. After sequencing, only one haplotype ofL. major, which is also the common haplotype present in Iran, including Fars and Isfahan Provinces, was detected from Abarkouh rodent samples (GenBank accession No. EF413075).
The low density of sampled rodents as well as Leishmaniaparasites may be due to a control program of the health care authorities of Abarkouh district that uses zinc phosphate poison and the destruction of rodents’ barrowers to control ZCL.
According to reports of different ZCL foci in Iran, many haplotypes of L. major have been identified in sandflies, rodents and humans7,11,15,27. The objective of the present study was to use molecular methods and different genes to identify additional Leishmania infections and various haplotypes; to this end, four different genes were employed to detect Leishmania infections in rodents and/or the numbers of haplotypes circulating in the area, but this method relies on a few sequences from all of the genes from our samples, and no variations were identified. We also used routine laboratory (conventional) methods, such as NNN cultures, microscopic observation and Balb/C mouse injection. Because most captured rodents died before being transferred to our lab, only a few live rodents were used for the conventional methods, and the infection rate was low. Only 2 infected samples were found by microscopic observation of the presence of amastigotes on slides and the appearance of a lesion after Balb/C mouse injection. Because the NNN cultures were prepared in the field and due to fungal infection in some cultures, no growth was shown in any of the cultures.
We employed five different genes during this investigation; the rodent Cyt b gene was amplified for accurate determination of the rodent’s genus and species. For Leishmania infection, two mitochondrial genes (kDNA and Leishmania Cyt b) and two nuclear genes (ITS-rDNA and microsatellite ITS-rDNA) were used. In this investigation, the highest infection rate among rodents (8/68) was detected using the microsatellite ITS-rDNA gene because of its short tandemly repeated DNA sequence fragments and because it is highly specific. A comparison of the rest of the genes demonstrated that Cyt b as a mitochondrial gene is more sensitive for Leishmania detection (4/68) because of its high copy numbers per cell; however, nuclear genes are more specific, and of those, the ITS-rDNA gene (3/68), because it is homogenous and highly conserved with few intracellular polymorphisms, a linear genome and has readable sequences, is considered a suitable gene for sequencing, genus, species, strain and/or even haplotype detection.
Our Leishmania infection data in rodents are similar to the results of a parallel study among sandflies and suspected patients that was carried out near the time of our investigation10 (Parvizi P et al: unpublished data).
In previous investigations, reservoir hosts of ZCL have been distributed in different regions. R. opimus and M. libycus are dominant in the northeastern and central regions; M. libycus and T. indica in the central and southwestern regions and T. indica in southwestern and southern Iran11,34. R. opimus and M. libycushave previously been found to be infected with L. major parasites from Golestan and Isfahan Provinces11,14,15,25. In addition, T. indica was found to be infected with L. major in Fars Province, Iran31. Interestingly, we were able to identify L. major infections in all three of these rodents within Abarkouh district of Yazd Province in central Iran.
In this survey, T. indica was captured for the first time in Abarkouh district; the existence of this rodent in the area may be explained by the fact that Abarkouh neighbors Fars Province, which is a known habitat forT. indica31, and the rodents can be transported and/or migrate to Abarkouh from Fars and vice versa. The simultaneous existence of T. indica along with R. opimus and M. libycus as main and potential reservoir hosts of ZCL in Abarkouh district and the fact that Abarkouh has been largely neglected as an important ZCL focus gives this district an important role in the ZCL life cycle, epidemiology, prognosis and disease-control programs.
Leishmania major was firmly identified in R. opimus, M. libycus and T. indica, which indicates that at least these three rodent species can be incriminated as reservoir hosts of ZCL in this location. R. opimus was abundant and had a greater rate of L. major infection and should be incriminated as the main reservoir host of ZCL35.