INTRODUCTION
Pseudomonas aeruginosa is the most frequent bacterial species associated with infections such as urinary tract infections, respiratory infections, dermatitis, soft tissue infections, gastrointestinal infections, and a variety of systemic infections, particularly in patients with severe burns, cancer, and acquired immunodeficiency syndrome (AIDS)1,2. Infections caused by P. aeruginosa develop intrinsically and may exhibit acquired resistance against various commonly prescribed antimicrobial drugs. In addition, infections caused by this organism are often difficult to treat, as they eventually reveal the emergence of multi-drug resistant Pseudomonas aeruginosa(MDRPA) isolates3. Nosocomial infection with MDRPA is a serious growing concern worldwide and is associated with higher morbidity, mortality, and cost of therapy4.
There are several mechanisms for the emergence of resistance to β-lactam antibiotics, with extended-spectrum β-lactamases (ESBLs) among the leading causes5,6. These enzymes are plasmid-encoded β-lactamases commonly found in Klebsiella pneumoniae and Escherichia coli and also observed in other clinical isolates of Enterobacteriaceae and Pseudomonas7–9. It is clear that the TEM (temoniera), SHV (sulfhydryl-variable), and CTX-M (cefotaximase) proteins are the principal types of ESBLs among clinically important Enterobacteriaceae species; however, the presence of less-studied types of ESBLs, including OXA (oxacillinase), VEB (Vietnamese extended spectrum β-lactamase), PER (Pseudomonas extended resistant), and GES (Guyana extended spectrum β-lactamase), has been reported in other bacterial species10,11. Recent studies have indicated that the dissemination of genes that encode ESBLs may play an important role in the spread of antibiotic resistance and may complicate the treatment of infections caused by P. aeruginosa because of limitations in therapeutic choices6,10. OXA-type enzymes belong to a growing family of ESBLs that differ from the TEM and SHV enzymes as they belong to the molecular class D and functional group 2d12,13. These β-lactamase enzymes have been found mainly in P. aeruginosa11. VEB-1 was initially observed in a single isolate of E. coli obtained from a Vietnamese patient but was later observed in a P. aeruginosa isolate from a Thai patient14. GES-1 is reported to not be closely related to any other plasmid-mediated β-lactamase; nevertheless, it demonstrates 36% homology to a carbenicillinase produced by Proteus mirabilis11. The PER-1 β-lactamase was first discovered in strains of P. aeruginosa isolated from patients in Turkey15. There are limited reports describing the prevalence of the OXA, VEB, PER, and GES types of ESBLs in clinical isolates of P. aeruginosa in Iran. The main aim of the present study was to determine the distribution of the bla OXA, bla PER-1, bla VEB-1, and bla GES-1-genes and resistance patterns among P. aeruginosa isolated from two distinct provinces in Iran.
METHODS
Study design and bacterial isolates
In this cross-sectional study, a total of 75 (27.5%) ESBL-producing isolates were identified from among 273 P. aeruginosa collected from hospitalized patients (one isolate per patient) in the Tehran and Qazvin provinces from January 2014 to October 2015. The bacterial isolates were collected from different clinical specimens including urine, wound, sputum, bronchoalveolar lavage, trachea, and blood samples. These isolates were obtained from patients who were admitted to intensive care units (ICUs), as well as internal medicine, general surgery, neurology, neurosurgery, and infectious disease wards. Duplicate isolates from the same patient were excluded. The study was approved by the Ethics Committee of Qazvin University of Medical Sciences (code IR.QUMS.REC.1394.147). Written informed consent was obtained from all subjects enrolled in this study. All isolates were identified as P. aeruginosa through the application of standard microbiological tests such as Gram staining, oxidase test, growth at 42°C, growth on cetrimide agar medium (Liofilchem, Roseto, Italy), O/F (oxidation/fermentation) test, and pigment production16. Isolates were stored at -70°C in trypticase soy broth containing 20% glycerol and were subcultured twice prior to testing.
ESBL detection and antimicrobial susceptibility
ESBL production was tested by phenotypic combined disk (CD) assay, as recommended by the Clinical and Laboratory Standards Institute (CLSI) guidelines17. All isolates were initially screened for ESBL production using the standard disk diffusion method, using ceftazidime (30µg), cefotaxime (30µg), ceftriaxone (30µg), cefpodoxim (30µg), and aztreonam disks (30µg) (Mast Diagnostics Group Ltd., Merseyside, UK). Isolates that were not susceptible to any of these antibiotics were further examined for ESBL production by the CD method, which compared the inhibition zones of disks containing cefotaxime or ceftazidime with and without clavulanic acid. ESBL production was confirmed by a ≥5mm increase in the diameter of the inhibition zone for ceftazidime/clavulanate (30/10µg) and cefotaxime/clavulanate (30/10µg) compared to the diameters of the inhibition zones in the absence of clavulanate. Antimicrobial susceptibility was further performed by the disk diffusion method using the following antibiotic disks (Mast Diagnostics Group Ltd.): cefepime (30µg), amikacin (30µg), aztreonam (30µg), ceftriaxone (30µg), imipenem (10µg), meropenem (10µg), gentamicin (10µg), piperacillin/tazobactam (100/10µg), piperacillin (100µg), carbenicillin (100μg), ceftazidim (30µg), cefotaxime (10µg), ciprofloxacin (5µg), levofloxacin (5µg), ofloxacin (10µg), ticarcillin (10µg), carbenicillin (10µg), tobramycin (10µg), colistin (30µg), and polymyxin B (300 units). P. aeruginosa American Type Culture Collection (ATCC) strain 27853 was used as the quality control strain in antimicrobial susceptibility testing.
Detection of bla OXA , bla PER , bla VEB , and bla GES genes
ESBL-producing isolates were subjected to polymerase chain reaction (PCR) for detection of bla OXA, bla PER-1 blaVEB-1, and bla GES-1 genes using the specific primers listed in Table 1 18–24. Total deoxyribonucleic acid (DNA) was extracted from bacterial isolates using an extraction kit (Bioneer, Daejeon, Korea). PCR amplification was performed in a thermocycler (Applied Biosystems, Carlsbad, CA, USA) as follows: 96oC for 5 min; 35 cycles of 1 min at 96oC, 1 min at a specific temperature for each primer, and 1 min at 72oC; and a final extension step of 10 min at 72oC. Amplification reactions were prepared in a total volume of 25μl including 12.5μl Taq DNA polymerase 2× Master Mix with 1.5mM MgCl2 (Ampliqon, Odense, Denmark), 0.5μM forward primer, 0.5μM reverse primer, 9μl nuclease free water, and 2.5μl DNA template (50pg concentration). PCR products were electrophoresed on a 1% agarose gel at 100V, stained with ethidium bromide solution, and finally visualized with a gel documentation system (UviTec, Cambridge, UK). Purified PCR products were sequenced by the Macrogen Company (Seoul, Korea), and sequence alignment and analysis were performed online using the basic local alignment search tool (BLAST) program of the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
TABLE 1 Primers used for detecting ESBL-encoding genes in this study.
| Primer | Target | Sequence (5′-3′) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|
| VEB-F VEB-B | VEB-1 | CGACTTCCATTTCCCGATGC GGACTCTGCAACAAATACGC | 55 | 18 |
| OXA-1-A OXA-1-B | OXA-1-group III | AGCCGTTAAAATTAAGCCC CTTGATTGAAGGATTGGGCG | 53 | 19 |
| OXA-2-F OXA-2-B | OXA-2-group II | GCCAAAGGCACGATAGTTGT GCGTCCGAGTTGACTGCCGG | 62 | 20 |
| OXA-10-F OXA-10-B | OXA-10-group I | TCTTTCGAGTACGGCATTAGC CCA ATGATGCCCTCACTTTCC | 56 | 18 |
| OXA-4-F OXA-4-B | OXA-4 | TCAACAGATATCTCTACTGTT TTTATCCCATTTGAATATGGT | 50 | 21 |
| PER-F PER-B | PER-1 | AATTTGGGCTTAGGGCAGAA ATGAATGTCATTATAAAAGC | 53 | 22 |
| GES-1-A GES-1-B | GES-1 | ATGCGCTTCATTCACGCAC CTATTTGTCCGTGCTCAGG | 53 | 23 |
| REP-1 REP-2 | REP-PCR | IIIGCGCCGICATCAGGC ACGTCTTATCAGGCCTAC | 45 | 24 |
ESBL: extended spectrum β-lactamase; VEB: Vietnamese extended spectrum β-lactamase; OXA: oxacillinase; PER: Pseudomonas extended resistant; GES: Guyana extended spectrum β-lactamase; REP: repetitive extragenic palindromic sequence-based.
Clonal analysis
Repetitive extragenic palindromic sequence-based PCR (REP-PCR) reactions were carried out in a final volume of 25µl, containing 2.5µl 10× PCR buffer, 0.5µl deoxynucleotide triphosphate (dNTP) Mix (10 mol), 5µl MgCl2, 25pM REP-primer F, 25pM REP-primer R24, 2U Taq DNA polymerase, 3µl extracted template DNA, and 16.1 µl distilled water. Amplification conditions were as follows: initial denaturation for 5 min at 95°C; 30 cycles of 1 min at 94°C, 1 min at 45°C, and 2 min at 72°C; and a final extension of 16 min at 72°C. PCR products were electrophoresed on a 1.2% agarose gel and stained with ethidium bromide. Analysis of REP-PCR profiles was performed by visual comparison of band patterns. Isolates with similar patterns (up to two bands different) were considered to belong to the same DNA group.
Statistical analysis
Statistical data analysis was performed using descriptive statistics including frequencies and cross-tabulation of microbiological and clinical features and demographic characteristics using the computer software program Statistical Package for the Social Sciences (SPSS Inc., Chicago, IL, USA) version 19.
RESULTS
ESBL-producing isolates were recovered from different clinical specimens including blood (24 isolates, 32%), urine (17, 22.7%), trachea (13, 17.3%), wound (9, 12%), sputum (6, 8%), and bronchoalveolar lavage (6, 8%) samples. Isolates were obtained from patients admitted to intensive care units (33 isolates, 44%) and internal medicine (19, 25.3%), infectious disease (12, 16%), general surgery (8, 10.7%), neurosurgery (2, 2.7%), and neurology (1, 1.3%) wards. There were 39 (52%) male and 36 (48%) female patients. A total of 59 (78.7%) ESBL-producing isolates were found to be multi-drug resistant P. aeruginosa (MDRPA), showing intermediate or complete resistance to at least three different classes of antimicrobial agents including β-lactams, aminoglycosides, and fluoroquinolones. The highest rates of susceptibility to the antimicrobials tested in this study were observed for colistin (75 isolates, 100%) and polymyxin B (75, 100%), followed by amikacin (44, 58.7%) and piperacillin-tazobactam (40, 53.3%). In addition, 41 (54.7%) and 40 (53.5%) isolates demonstrated complete or intermediate resistance to meropenem and imipenem, respectively (Table 2).
TABLE 2 Antimicrobial susceptibility of ESBL-producing Pseudomonas aeruginosa isolated from hospitals in Qazvin and Tehran (n = 75).
| Antibiotic | Susceptible | Intermediate | Resistant |
|---|---|---|---|
| n (%) | n (%) | n (%) | |
| Colistin | 75 (100.0) | – | – |
| Polymyxin B | 75 (100.0) | – | – |
| Amikacin | 44 (58.7) | 10 (13.3) | 21 (28.0) |
| Piperacillin-tazobactam | 40 (53.3) | 9 (12.0) | 26 (34.7) |
| Imipenem | 35 (46.7) | 9 (12.0) | 31 (41.3) |
| Meropenem | 34 (45.3) | 7 (9.3) | 34 (45.3) |
| Cefepime | 30 (40.0) | 1 (1.3) | 44 (58.7) |
| Piperacillin | 26 (34.7) | 8 (10.7) | 41 (54.7) |
| Ciprofloxacin | 24 (32.0) | 1 (1.3) | 50 (66.7) |
| Gentamicin | 22 (29.3) | – | 53 (70.7) |
| Ceftazidime | 22 (29.3) | 4 (5.3) | 49 (65.3) |
| Tobramycin | 22 (29.3) | 3 (4.0) | 50 (66.7) |
| Ofloxacin | 21 (28.0) | 2 (2.7) | 52 (69.3) |
| Levofloxacin | 18 (24.0) | 2 (2.7) | 55 (73.3) |
| Ticarcillin | 17 (22.7) | 1 (1.3) | 57 (76.0) |
| Aztreonam | 14 (18.7) | 10 (13.3) | 51 (68.0) |
| Carbenicillin | 14 (18.7) | 3 (4.0) | 58 (77.3) |
| Ceftriaxone | 10 (13.3) | 7 (9.3) | 58 (77.3) |
| Cefotaxime | 5 (6.7) | 8 (10.7) | 62 (82.7) |
Among the 75 isolates, bla OXA-1 (28/37.3%) was the most common ESBL-encoding gene among those investigated, followed by bla OXA-4 (32%), bla GES-1 (16%), and bla VEB-1 (13.3%). The study isolates were negative for bla OXA-10, bla PER-1, and bla OXA-2. The bla OXA-1 gene was found to coexist with bla OXA-4 in 14 (18.7%) isolates; two (2.7%) isolates also carried both bla OXA-1 and bla GES-1, and one (1.3%) isolate carried the bla OXA-1 , bla OXA-4 , bla GES-1, and bla VEB-1 genes (Table 3). Overall, bla OXA-1-positive (24%) and bla OXA-4-positive (20%) isolates were mostly collected from Tehran hospitals, whereas bla GES-1-positive (16%) and blaVEB-1-positive (13.3%) isolates all derived from Qazvin hospitals.
TABLE 3 REP-PCR genotyping of ESBL-positive Pseudomonas aeruginosa isolates.
| Isolates | ||||
|---|---|---|---|---|
| Type A | Type B | Type C | Total | |
| Gene | n (%) | n (%) | n (%) | n (%) |
| bla OXA-1 | 10 (13.3) | 1 (1.3) | – | 11 (14.7) |
| bla OXA-4 | 6 (8.0) | – | 1 (1.3) | 7 (9.3) |
| bla GES-1 | 6 (8.0) | – | – | 6 (8.0) |
| bla VEB-1 | 5 (6.7) | 2 (2.7) | – | 7 (9.3) |
| bla OXA-1 and bla OXA-4 | 12 (16.0) | 2 (2.7) | – | 14 (18.7) |
| bla OXA-1 and bla GES-1 | 1 (1.3) | – | 1 (1.3) | 2 (2.7) |
| bla OXA-4 and bla GES-1 | 2 (2.7) | – | – | 2 (2.7) |
| bla VEB-1 and bla GES-1 | 1 (1.3) | – | – | 1 (1.3) |
| bla OXA-1 , bla OXA-4 , bla GES-1, and bla VEB-1 | 1 (1.3) | – | – | 1 (1.3) |
| No bla OXA-1, bla OXA-4, bla GES-1, or bla VEB-1 | 23 (30.7) | – | 1 (1.3) | 24 (32.0) |
| Total | 67 (89.3) | 5 (6.7) | 3 (4.) | 75 (100.) |
REP-PCR: repetitive extragenic palindromic sequence-based-PCR; ESBL: extended spectrum β-lactamase.
Molecular genotyping by REP-PCR showed that the 75 ESBL-producing isolates belonged to three distinct genotypes, named the A, B, and C genotypes. Among ESBL producers, 67 (89.3%), five (6.7%), and three (4%) isolates belonged to types A, B, and C, respectively. As shown in Table 3, the most frequent ESBL gene detected among the isolates of the current study, bla OXA-1, was found in isolates belonging to the A (24, 31.9%) and B (3, 4%) genotypes, either alone or in combination.
DISCUSSION
ESBL-producing P. aeruginosa has recently emerged as a major cause of health-care associated infections25,26. The treatment of infections caused by these resistant organisms is increasingly complicated owing to the high levels of resistance to the most commonly prescribed antibiotics in hospital settings27. Several studies carried out by Mirsalehian et al.28, Farshadzadeh et al.29, and Shakibaie et al.30 covering three distinct burn centers throughout the country, as well as a study by Alikhani et al.31 in two training hospitals affiliated with the Hamadan University of Medical Sciences have described the existence of ESBLs among clinical isolates of P. aeruginosa. We previously revealed the appearance of metallo-β-lactamases (MBLs) among clinical isolates of P. aeruginosa in Iran32. ESBL producers are reported to be present in other Asian countries, such as India and Bangladesh, from where several reports by Senthamaria et al.33 Umadevi et al.34, and Begum et al.35 are available. In the current study, 78.7% of ESBL-producing isolates were found to be MDRPA, exhibiting relatively high resistance rates to most antibiotics tested with the exception of polymyxin B and colistin, indicating that available choices for the treatment of these infections are currently limited.
Pseudomonas aeruginosa isolates exhibited the highest rates of susceptibility to the antimicrobials tested in this study. The inappropriate management of infections in terms of excessive use of antibiotics is likely to be a major predisposing factor in the emergence of resistant bacteria in hospital settings. These data highlight the necessity for establishing both a local and nationwide antimicrobial resistance surveillance system to monitor the possible appearance of resistance within our healthcare system. Moreover, the results of the present study show that ESBL-producing isolates mostly derive from patients admitted to ICUs. This may reflect a greater clinical impact, as the patients admitted to these wards likely face more chronic underlying conditions and are exposed to broad-spectrum antibiotics and medical manipulations through the use of invasive devices. However, it should be noted that the distribution of nosocomial microorganisms varies widely on different continents and in different regions, countries, hospitals, and even in different areas of the same hospital. Patient factors such as age, infection severity, immune response, and length of hospital stay also affect the presence of these microorganisms. Furthermore, hospital-related factors, such as the availability and use of broad-spectrum antibiotics and the diagnostic and therapeutic procedures employed, should also be taken into account, though data on these factors are limited.
In the present study, 37.3%, 32%, 16%, and 13.3% of ESBL-producing P. aeruginosa isolates carried the blaOXA-1, bla OXA-4, bla GES-1, and bla VEB-1 genes, respectively, alone or in combination. In a study from Iran, Shahcheraghi et al. reported that 24%, 17%, and 0% of MDRPA isolates harbored the bla VEB, bla PER, and blaGES genes, respectively23. Mirsalehian et al. reported that 74.6%, 49.2%, and 31.3% of ESBL-producing isolates of P. aeruginosa collected from patients at Motahhari Burn Hospital in Tehran were positive for bla OXA-10, blaPER-1, and bla VEB-1, respectively28. In another study conducted by Rafiee et al. at the same burn center, it was shown that 21.6% of P. aeruginosa isolates carried the bla PER-1 gene13. Farshadzadeh et al., in a study carried out at the Taleghani Burn Hospital in Ahvaz (Iran), reported that 54.2% and 68.7% of ESBL-producing isolates of P. aeruginosa harbored bla PER-1 and bla OXA-10, respectively29. Among the studies reported from Asian countries, Lee and colleagues from South Korea showed that 6.3%, 13.1%, 4.3%, 2.0%, 2.3%, and 0.4% of P. aeruginosa isolates carried the bla PSE-1, bla OXA-10 , bla OXA-4 , bla OXA-30 , bla OXA-2, and bla OXA-17 genes, respectively36. In another study performed in Saudi Arabia, the presence of genes encoding VEB-1, OXA-10, and GES was confirmed among extended-spectrum cephalosporin-non-susceptible P. aeruginosa clinical isolates from burn patients10. Together, these data indicate the successful spread of ESBL-encoding genes around the world.
In the present study, the application of REP-PCR for molecular genotyping showed the presence of three separate clones of ESBL-producing P. aeruginosa. Genotype A was the most common (89.3%) within the hospitals under evaluation, which is strongly associated with the clonal spread of these resistant organism and patient-to-patient transmission. The distribution of ESBL genes among different clones in the current study suggests not only the clonal spread of ESBL-producing isolates among different wards but also the spread of resistance genes among these bacterial strains.
In conclusion, the presence of ESBL-producing P. aeruginosa in clinical settings has become a serious concern owing to the fact that these strains exhibit a wide range of resistances not only to β-lactam but frequently to other classes of antibiotics. Moreover, the genes encoding these enzymes are often carried on mobile elements that can quickly spread between different strains via horizontal transfer. The identification of ESBLs, introduction of appropriate infection control measures, and justified antibiotic use are necessary to prevent the further spread of infections by these organisms.
