Oral candidiasis is the most common opportunistic fungal infection in individuals infected with the human immunodeficiency virus (HIV) and is considered an independent predictor of immunodeficiency in patients with acquired immunodeficiency syndrome (AIDS)1,2. In addition, esophageal candidiasis is considered to be an AIDS-defining condition3. Clinical features of oral thrush and esophageal candidiasis comprise white oral patches; oral ulcers and painful swallowing may also be observed4.
The cluster of differentiation 4+ (CD4+) T-lymphocyte count in peripheral blood is an important marker of the patient’s immune status and of their susceptibility to the development of opportunistic infections, such as oropharyngeal candidiasis5. Although Candida albicans is the most frequently-isolated species related to oral opportunistic infections, an increase in the frequency of oral infections caused by non-albicans species such as Candida tropicalis, Candida parapsilosis, Candida glabrata, Candida krusei and Candida dubliniensis has been observed in the last decade1,2.
Identification of the species is important for epidemiological reasons and for treatment purposes to ensure a better prognosis since some species present reduced susceptibility to azoles2,4,5. Therefore, the present study aimed to investigate the correlation between the presence of oral lesions caused by Candida spp. with the level of CD4+ T-lymphocyte in HIV-positive patients, and to determine the distribution and antifungal susceptibility of Candida species isolated from the oral cavities of HIV-positive patients, with and without lesions.
A total of 60 seropositive HIV patients [diagnosed by enzyme-linked immunosorbent assay (ELISA) and Western-blot] admitted at the University Hospital Maria Aparecida Pedrossian (UH-MAP), Mato Grosso do Sul, Brazil, were included in this study. The participants were recruited from December 2014 to July 2015 and data such as age, gender, hospitalization, the presence of oral lesions and CD4+ T-lymphocyte counts were obtained from their medical records. To compare the possible associations between the variables under study, the chi-square test and Fisher’s exact test were applied, as appropriate. Statistical analyses were performed using the program Minitab, version 16 (Minitab Inc., State College, PA, USA).
Samples collected via oral swab were inoculated in Sabouraud-dextrose broth (Himedia, India). After 24h at 35ºC, the samples were plated in Sabouraud-dextrose agar (Himedia, India) for 24h at 35ºC. Suggestive colonies of Candida spp. were then plated in CHROMagar Candida (Difco, USA) for 48h at 35°C for presumptive identification. For genotypic identification, genomic deoxyribonucleic acid (DNA) was extracted and purified using the YeaStar™ DNA Extraction Kit (Zymo Research, USA) in accordance with the manufacturer’s instructions.
For the initial differentiation among Candida species, multiplex polymerase chain reaction technique (PCRm) was performed as described by Li et al.6. For the differentiation between C. albicans and C. dubliniensis, C. parapsilosis complex and C. glabrata complex, the following techniques were performed respectively: duplex PCR7, PCR followed by restriction fragment length polymorphism8and PCRm9. All the primers used in the PCR techniques are described in Table 1.
TABLE 1: Primers used in the molecular identification of Candida species.
| Primer | Sequence (5’ → 3’) | Reference |
|---|---|---|
| CL | GTTAGGCGTTGCTCCGAAAT | Li et al.6 |
| CP | GGCGGAGTATAAAGTAATGGATAG | |
| CT | AAGAATTTAACGTGGAAACTTA | |
| CGU | GTATTG GCA TGG GTA GTA CTG | |
| CA | TCAACTTGTCACACCAGATTATT3 | |
| CK | GAT TTAGTACTACACTGCGTG A | |
| CGL | CACGACTCGACACTTTCTAATT | |
| CALF | TGGTAAGGCGGGATCGCTT | Ahmad et al.7 |
| CALR | GGTCAAAGTTTGAAGATATAC | |
| CDUF | AAACTTGTCACGAGATTATTTTT | |
| CDUR | AAAGTTTGAAGAATAAAATGGC | |
| S1F | GTTGATGCTGTTGGATTGT | Tavanti et al.8 |
| S1R | CAATGCCAAATCTCCCAA | |
| UNI-5.8S | ACCAGAGGGCGCAATGTG | Romeo et al.9 |
| GLA-f | CGGTTGGTGGGTGTTCTGC | |
| NIV-f | AGGGAGGAGTTTGTATCTTTCAAC | |
| BRA-f | GGGACGGTAAGTCTCCCG |
CL: Candida lusitaniae; CP: Candida parapsilosis complex; CT: Candida tropicalis; CGU: Candida guillermondii; CA: Candida albicans; CK: Candida krusei; CGL: Candida glabrata species-specificity primers; CALF + CALR and CDUF + CDUR: species-specificity primers pairs for Candida albicans and Candida dubliniensis identification, respectively; S1F and S1R: primer sequences used for identification of species of Candida parapsilosis complex; UNI-5.8S, GLA-f, NIV-f and BRA-f: primer sequences used for identification of species of Candida glabrata complex.
The minimum inhibitory concentrations (MIC) of the antifungal agents fluconazole (Pfizer, Brazil), itraconazole (Sigma, USA), voriconazole (Sigma, USA) and amphotericin B (Sigma, USA) were determined using the broth microdilution method. ATCC strains (C. krusei ATCC 6258 and C. parapsilosis ATCC 22019) were used as quality control. The MIC results were interpreted according to the Clinical and Laboratory Standards Institute breakpoints10.
Ethical considerations
The study protocol was approved by the Research Ethics Committee of the Federal University of Mato Grosso do Sul. All patients who agreed to participate in this study signed a consent form. To our knowledge, this is the first study on oral candidiasis in the State of Mato Grosso do Sul, Midwest Region, Brazil.
The patients’ ages ranged from 24 to 76 years, with a mean of 42.3 years, and with male predominance (75.8%). Similar to previous studies2,4, the most affected age group was 24 to 40 years, which is the most sexually active population. The prevalence of male HIV-positive patients related to oropharyngeal candidiasis had been reported previously4. Patients’ clinical, demographic and hospital admission data are summarized in Table 2.
TABLE 2: Distribution of 66 HIV-positive patients according to demographic characteristics, unit of attendance, oral lesions, and immunological evaluation
| Variable | Number | Percentage | p value* |
|---|---|---|---|
| Gender | < 0.001 | ||
| male (M) | 50 | 75.8 | |
| female (F) | 16 | 24.2 | |
| Age (years) | < 0.001 | ||
| 24 – 40 | 36 | 54.5 | |
| 41 – 60 | 25 | 37.9 | |
| > 60 | 5 | 7.6 | |
| Attendance unit | <0.001 | ||
| infectious and parasitic diseases/ward | 47 | 71.2 | |
| day-care hospital | 17 | 25.8 | |
| adult intensive care | 2 | 3.0 | |
| Presence of oral lesions | < 0.001 | ||
| yes | 16 | 24.2 | |
| no | 50 | 75.8 | |
| Type of oral lesions | 0.14 | ||
| pseudomembranous | 8 | 50.0 | |
| erythematous | 3 | 18.8 | |
| chronic multifocal | 3 | 18.8 | |
| angular cheilitis | 2 | 12.5 | |
| Correlation: species vs type of interaction | 0.15 | ||
| Infection | |||
| C. albicans | 10 | 33.3 | |
| non-albicans Candida | 3 | 20.0 | |
| Colonization | |||
| C. albicans | 20 | 66.7 | |
| non-albicans Candida | 12 | 80.0 | |
| Correlation: species vs lesion form | 0.50 | ||
| C. albicans | |||
| pseudomembranous | 5 | 83.3 | |
| erythematous | 2 | 66.7 | |
| C. tropicalis | |||
| pseudomembranous | 1 | 16.7 | |
| erythematous | 1 | 33.3 | |
| TCD4 + lymphocytes count (cells/µL) | 0.03 | ||
| ≤200 | 42 | 63.6 | |
| >200 | 24 | 36.4 |
HIV: human immunodeficiency virus; C. : Candida; TCD4+: cluster of differentation 4+ T-cell counts; *Fisher’s exact test.
According to a previous study, variations in the clinical aspects of oral candidiasis have been associated with the progression of HIV infection as the CD4+ T-lymphocyte counts decrease11. In our study, 16 (24.2%) out of 66 patients presented oral lesions with the following features: pseudomembranous (8, 50%), erythematous (3, 18.7%), chronic multifocal (3, 18.7%) and angular cheilitis (2, 12.5%). Candidiasis with pseudomembranous lesion as observed in most cases in our study is consistent with the findings of other authors2,11.
There was no significant correlation between species and type of host-parasite relationship and between species and clinical presentation of oral lesions (Table 2). However, the number of cases was small and these results should be re-evaluated in a larger number of patients.
Among the 16 individuals with oral lesions, 15 (93.7%) had CD4+ T-lymphocyte counts ≤ 200 cells/μL (p < 0.05) showing that oral candidiasis is a highly predictive marker of immunosuppression, as previously reported5,11. Despite having no apparent lesion, 32 (48.5%) patients had Candida spp. isolated from their oral cavities, demonstrating colonization. Previous studies have shown that in Brazil, the rate of colonization has ranged from 50.4% to 62.0% in this group of patients1,12,13. The use of antibiotics and oral prostheses are some of the predisposing factors for oral colonization by Candida spp.1.
Among the 45 Candida spp. isolates, C. albicans (30, 66.7%) was prevalent in relation to non-albicans species (15, 33.3%), confirming the results of previous studies1,2,4,13–15. The following non-albicans species were identified: C. tropicalis (6, 13.3%), C. krusei (4, 8.9%), C. parapsilosis sensu stricto (2, 4.4%), C. glabrata sensu stricto (2, 4.4%) and C. dubliniensis (1, 2.2%).
Studies carried out in São Paulo showed that among non-albicans isolates, C. glabrata was the most frequently-isolated species from the saliva of HIV-infected patients without clinical lesions13 while in other cities of the Southeastern region of Brazil such as São José dos Campos-SP and Uberlândia-MG, the most commonly isolated non-albicans species from oropharyngeal candidiasis were C. tropicalis15 and C. parapsilosis1, respectively. This fact shows that the distribution of non-albicans isolates from the oral cavity varies from region to region
To assist the clinician in making therapeutic decisions and to optimize treatment, clinical microbiologists should identify Candida to the species level, especially in HIV-positive patients, in whom non-albicans species are being increasingly recognized to cause serious infections4.
With the advent of molecular biology techniques, it was possible to differentiate species such as C. albicans and C. dubliniensis, C. parapsilosis complex and C. glabrata complex. Although C. dubliniensis has been associated with oral candidiasis in HIV infected patients worldwide, in our study, as in other Brazilian studies12,13, the prevalence rate of this species was considered low.
The in vitro susceptibility profiles of the Candida species studied are shown in Table 3. Candida albicans, C. tropicalis, C. krusei, C. parapsilosis sensu stricto and C. dubliniensis presented susceptibility to all antifungal agents tested. Two isolates of C. glabrata sensu stricto showed dose-dependent susceptibility to fluconazole and one dose-dependent susceptibility to itraconazole.
TABLE 3: In vitro antifungal susceptibility of Candida species isolated from the oral cavities of HIV-positive patients.
| Candida species | Antifungal agent | MICs in μg/mL | |
|---|---|---|---|
| MIC range | MIC50/90* | ||
| C. albicans (n= 300) | Fluconazole | 0.125 – 0.500 | 0,125/0,25 |
| Itraconazole | 0.003 – 0.125 | 0,015/0,06 | |
| Voriconazole | 0.015 – 0.06 | 0,015/0,015 | |
| Amphotericin B | 0.06 – 0.5 | 0,5/0,5 | |
| C. tropicalis (n=6) | Fluconazole | 0.125 – 0.500 | 0,5/0,5 |
| Itraconazole | 0.015 – 0.06 | 0,06/0,060 | |
| Voriconazole | 0.015 | 0,015/0,015 | |
| Amphotericin B | 0.5 – 1 | 0,5/0,5 | |
| C. krusei (n=4)** | Fluconazole | – | – |
| Itraconazole | 0.015 – 0.125 | 0,03/0,03 | |
| Voriconazole | 0.015 – 0.06 | 0,03/0,03 | |
| Amphotericin B | 0.5 – 1.0 | 1/1 | |
| C. glabrata sensu stricto (n=2) | Fluconazole | 4.0 – 8.0 | |
| Itraconazole | 0.03 – 0.250 | ||
| Voriconazole | 0.06 – 0.125 | ||
| Amphotericin B | 1 | ||
| C. parapsilosis sensu stricto (n=2) | Fluconazole | 0.125 – 0.5 | |
| Itraconazole | 0.015- 0.06 | ||
| Voriconazole | 0.015 | ||
| Amphotericin B | 0.06 – 0.5 | ||
| C. dubliniensis (n=1) | Fluconazole | 0.125 | |
| Itraconazole | 0.015 | ||
| Voriconazole | 0.015 | ||
| Amphotericin B | 0.06 | ||
HIV: human immunodeficiency virus; C. : Candida; MIC: minimum inhibitory concentration as defined by the CLSI; CLSI: Clinical and Laboratory Standards Institute. *MIC50 and MIC90: MIC at which 50% and 90% of the isolates were inhibited. **C. krusei is intrinsically resistant to fluconazole, independent of the MIC result obtained in vitro.
The pattern of antifungal resistance also varies with geographical region. In contrast to previous studies carried out in other Brazilian regions12,14, non-albicans species isolated from patients living in Mato Grosso do Sul State, showed a high susceptibility to the antifungal agents tested.
In conclusion, individuals with high levels of immunosuppression are more susceptible to the development of oral candidiasis. The presence of oral lesions caused by Candida spp., mainly of the pseudomembranous form, can act as an indirect marker of immunosuppression in HIV-positive patients.
In addition, Candida spp. are commonly found among HIV-positive patients with and without oral lesions. Although C. albicans is the most frequent species isolated in the oral mucosa, non-albicans isolates represent a relevant percentage of isolates. Despite the good in vitro susceptibility, the lower susceptibility to azoles by non-albicans isolates supports the importance of surveillance studies using susceptibility tests to achieve better results in the pharmacological treatment of oropharyngeal candidiasis.
