Carla Isabel Macedo; Pedro Carnieli Junior; Willian de Oliveira Fahl; Jonas Yoshitaka de Oliveira Lima; Rafael de Novaes Oliveira; Samira Maria Achkar; Juliana Galera Castilho; Maria Luiza Carrieri; Ivanete Kotait
Institute Pasteur, Virology Department. São Paulo, SP. Brazil
ABSTRACT
INTRODUCTION: Rabies is an acute disease of the central nervous system and is responsible for the deaths of thousands of humans, wild animals and livestock, particularly cattle, as well as causing major economic losses. This study describes the genetic characterization of rabies virus variants that circulate in Desmodus rotundus populations and are transmitted to herbivores.
METHODS: Fifty rabies virus isolates from bovines and equines in the States of São Paulo and Minas Gerais, Brazil, were genetically characterized and compared with sequences retrieved from GenBank.
RESULTS: Two clusters (I and II) with mean nucleotide identities of 99.1 and 97.6% were found. The first of these contained nearly all the samples analyzed. Lineages from other Brazilian states grouped in cluster II.
CONCLUSIONS: Analysis of the amino acid sequences of the N proteins revealed the existence of genetic markers that may indicate possible variations between geographic regions, although the biologically active regions are conserved within the species over space and time.
Key-words: Rabies virus. Desmodus rotundus. Genetic characterization. Nucleoprotein gene. Cattle.
RESUMO
INTRODUÇÃO: A raiva é uma doença aguda do sistema nervoso central e é responsável por mortes de milhares de humanos, animais silvestres e animais de criação – especialmente bovinos – além de causar elevadas perdas econômicas. Este trabalho descreve a caracterização genética das variantes do vírus da raiva que circulam em populações de Desmodus rotundus e são transmitidas aos herbívoros.
MÉTODOS: Cinquenta isolados de vírus da raiva de bovinos e equinos provenientes dos Estados de São Paulo e Minas Gerais, Brasil, foram caracterizadas geneticamente e comparadas com sequências recuperadas do GenBank.
RESULTADOS: Dois clusters, I e II, apresentando identidades médias de nucleotídeos de 99,1 e 97,6%, foram obtidos, sendo o primeiro composto de quase a totalidade das amostras analisadas. Linhagens de outros estados do Brasil “clustered” no II.
CONCLUSÕES: A análise das sequências de aminoácidos da proteína N revelou que existem marcadores genéticos que podem determinar uma possível regionalidade embora as regiões biologicamente ativas apresentem-se conservadas dentro das espécies ao longo do tempo e espaço.
Palavras-chaves: Vírus da raiva. Desmodus rotundus. Caracterização genética. Gene da nucleoproteína. Bovinos.
INTRODUCTION
Rabies is an acute disease of the central nervous system that has almost worldwide distribution and can affect all mammals. The rabies virus (RABV) belongs to genotype 1 of the genus Lyssavirus in the family Rhabdoviridae1. Infection by the virus is responsible for the deaths of thousands of humans, wild animals and livestock, particularly bovines, as well as causing major economic losses. In 2007, Brazilian livestock experts calculated that there had been 25,000 cases of bovine rabies in Brazil, when undernotification and clinical diagnoses were taken into account2. While traditional viral detection methods can monitor the presence of RABV transmitted to herbivores, only techniques such as the polymerase chain reaction (PCR) and genetic sequencing can determine whether the virus genetic makeup varies with geographic distribution.
In Latin America, practically all cases of rabies in herbivores are transmitted by the hematophagous bat Desmodus rotundus. Although the virus can be genetically characterized using samples from hematophagous bats, the rate of positive rabies findings in these animals and in non-hematophagous bats in the State of São Paulo is low (1-2%)3,4. Genetic characterization of RABV samples isolated from bovines can provide important information about possible differences in the genetic lineages of the virus circulating in Desmodus rotundus populations. These differences are the result of mutations that occur randomly in different geographic regions and over time.
The aim of this study was to genetically characterize the RABV lineages in the States of São Paulo and Minas Gerais in the years 2007 and 2008 that were transmitted by Desmodus rotundus and circulating in herbivores. Molecular methods were used to analyze the segment of the genome that encodes the N protein, and the resulting data are expected to be of benefit for studies on the epidemiology and geographic distribution patterns of rabies.
METHODS
Samples
To study the nucleoprotein (N) gene in antigenic variant 3 (AgV3) lineages, which are characteristic of Desmodus rotundus, a total of 50 central nervous system samples (40 from bovines and 10 from equines, GenBank accession numbers GQ160910 to GQ160959) were sequenced genetically (Table 1). These samples had originated from the states of São Paulo (SP) and Minas Gerais (MG) (Figure 1) in the years 2007 and 2008 and had been sent to the Pasteur Institute of São Paulo to be analyzed for rabies.
Direct immunofluorescence and mouse inoculation test
The central nervous system samples were diagnosed positive for rabies by inoculation in mice, as described by Koprowski5, and by the direct immunofluorescence test6 using fluorescein isothiocyanate-labeled anti-nucleocapsid polyclonal antibodies.
Reverse transcriptase-polymerase chain reaction, DNA sequencing and phylogenetic analysis
RNA was extracted from the 50 samples using TRizol® reagent (Invitrogen), in accordance with the manufacturer’s instructions. RT-PCR was carried out using the 21G sense (ATGTAACACCTCTACAATG) and 304 antisense (TTGACGAAGATCTTGCTCAT)7 primers and the protocol described by Macedo et al8.
The amplified DNA fragments were purified with GFX PCR DNA and the Gel Band Purification kit (Amersham Biosciences™) and subjected to sequencing reactions using sense and antisense primers with the BigDye Terminator v3.1 cycle sequencing kit (Amersham Biosciences™) in accordance with the manufacturer’s instructions. The sequencing was carried out in an Applied Biosystems 3,130 automated DNA sequencer. A 1,320-nucleotide region corresponding to the portion of the nucleoprotein gene located between nucleotides (nt) 30 and 1,350 of the PV strain (GenBank accession number M13215.1) was analyzed. Data from raw sequencing were edited using CHROMAS software (version 2.24 © 1998-2004 Technelysium Pty Ltd), and the final sequences were aligned with sequences present in GenBank (Table 2) by the CLUSTAL/W method using BioEdit software9. The alignments were used to build neighbor-joining distance-based DNA phylogenetic trees with the Kimura-2 parameter correction model and 1,000 bootstrap repetitions for statistical support using the Mega 2.1 program10. The nucleotide and amino acid identities were calculated using BioEdit software.
RESULTS
Direct immunofluorescence and mouse inoculation test
All 50 AgV3 RABV lineages used in this study were positive for FAT and MIT.
Phylogenetic analysis
Phylogenetic analysis was carried out using the sequences corresponding to the N gene (1,320 nt). The lineages segregated into two clusters (I and II), and the first of these was divided into six subclusters (Ia to If) (Figure 2). The relationship between the clusters and subclusters and their geographic distribution (areas X1 to X4) can be seen in Figure 1.
Cluster I, which was made up of sequences from samples that originated in SP and MG and a single sample from Goiânia, State of Goiás, had 99.1% mean nucleotide identity. Subclusters Ia to If had mean identities of more than 99%, and the identities between them ranged from 99 to 99.7%. Cluster II consists of sequences from the States of Goiás (GO), Mato Grosso (MT), Tocantins (TO) and Rio de Janeiro (RJ), as well as some sequences from São Paulo (SP). The mean identity within this cluster was 97.7%, and the mean identity between clusters I and II was 96.8%.
The changes in the nucleotides resulted in few changes in the amino acid (aa) sequences analyzed. Comparison between the predicted sequences of amino acids in the N protein in this study and the putative aa alignments revealed a region that characterized clusters I and II.
The aa identified at the position corresponding to position 50 of the complete coding of the N gene was histidine (H), and it was therefore this amino acid that characterized the sequence in this cluster, with the exception of subcluster If, in which this position was occupied by asparagine (N). Asparagine (N) was also identified in cluster II at the same position in two sequences from SP (municipalities of São Roque and Mococa) and in the sequences from GO and RJ. In all the other sequences from SP, as well as those from MT and TO, the amino acid serine (S) was identified at the same position. The amino acids cited above thus represent the genetic markers for clusters I and II (Figure 3).
Wunner11 provided descriptions of biologically active areas of the N protein, and these were analyzed in the present study. For this purpose, we used the vaccine strain PV (GenBank accession number M13215) as a reference. A mutation was found in antigenic site III between amino acids 313 and 337. In the lineages studied here, a threonine residue was found at position 332, while in the PV lineage, alanine (nonpolar) was found at this position.
The regions from aa 358 to 367 in antigenic site I and from aa 359 to 366 in antigenic site IV were conserved, while the region from aa 375 to 383, also in antigenic site IV, contained three mutations: alanine, glutamic acid and threonine at positions 377, 378 and 379, respectively, instead of threonine, aspartic acid and valine, which are found at these positions in the PV.
In addition to the antigenic sites analyzed, the N protein has immunodominant helper T-cell epitopes between aa 404 and 418. In the lineages analyzed here, a mutation (a methionine residue instead of the isoleucine residue present in the PV strain) was found in this region at position 410. The serine residue at position 389, which is phosphorylated after binding with the viral RNA, was conserved in the lineages analyzed.
DISCUSSION
In this study, we analyzed AgV3 RABV lineages from SP and MG collected in 2007 and 2008. These lineages were compared with lineages from SP and MG collected between 1999 and 200112 and from SP, RJ, MT, GO and TO collected between 1989 and 200613,14.
Two clusters were identified in the study (I and II). Cluster I was made up of AgV3 RABV lineages from SP and MG collected between 1999 and 2001 and between 2007 and 2008 and a single lineage from GO collected in 1999. Cluster II consisted of lineages from SP, RJ, MT, GO and TO collected between 1989 and 2000 and four lineages from SP collected between 2007 and 2008.
A high degree of identity between lineages was observed for cluster I (greater than 99%), and cluster II was found to have 97% identity. The mean identity between clusters I and II was 96.8%. These results are in agreement with data obtained in Latin America by other authors12,14-16, who rarely found more than 2-3% divergence between AgV3 RABV lineages.
We also found that, although the distributions of some clusters overlapped, variations between lineages from different geographic regions could be observed, as was the case with subclusters Ie and If. In addition, the lineages used for comparison, which were mostly from other states, segregated into a different cluster from the majority of the lineages from SP and MG. This variation with geographic region has also been observed by other authors12,15,17,18.
The analysis on the amino acid sequences of the N protein of the AgV3 RABV lineages studied here revealed that this site provided information that helped differentiate between the lineages. While the amino acid residue at position 50 in cluster I in almost all lineages was histidine, the amino acids at the same position in the lineages in cluster II were serine or asparagine. Carnieli et al12found differences in the same site, thus characterizing lineages from distinct areas.
Comparing the biologically active areas of the N protein, we found that the amino acids at these positions were conserved in the AgV3 lineages, as can also be seen from studies by Carnieli et al12and Oliveira19, and to a certain extent from a study by Velasco-Villa et al16, who only analyzed the C-terminal region of the N gene.
Epidemiological surveillance using molecular methods such as that described here is very important in planning actions to control rabies. In this study, we analyzed RABV lineages isolated from economically important herbivores. Despite exhibiting genetic markers that could indicate variation with geographic region, these lineages, which were typical of those isolated from the hematophagous bat Desmodus rotundus, had biologically active regions that were conserved within the species over space and time. These findings may be of benefit when planning actions aimed at regional control of rabies in bovines.
CONFLICT OF INTEREST
The authors declare that there is no conflict of interest.
REFERENCES
1. Van Regenmortel MHV, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, et al. Virus Taxonomy: the classification and nomenclature of viruses. The Seventh Report of the International Committee on Taxonomy of Viruses. San Diego: Academic Press; 2000. [ Links ]
2. Ministério da Agricultura Pecuária e Abastecimento [Internet]. Coordenação da Raiva dos Herbívoros do Ministério da Agricultura, Pecuária e Abastecimento. [2007] – [cited 2007 Dec 10]. Available from: htpp//www.agricultura.gov.br. [ Links ]
3. Queiroz LH, Carvalho C, Buso DS, Ferrari CIL, Pedro WA. Perfil epidemiológico da raiva na região Noroeste do Estado de São Paulo no período de 1993 a 2007. Rev Soc Bras Med Trop 2009; 42: 9-14. [ Links ]
4. Scheffer KC, Carrieri ML, Albas A, Santos CP, Kotait I, Ito FH. Rabies virus in naturally infected bats in the State of São Paulo, Southeastern Brazil. Rev Saude Publica 2007; 41: 389-395. [ Links ]
5. Koprowski H. The mouse inoculation test. In: Meslin FX, Kaplan MM, Koprowski H, editores. Laboratory techniques in rabies. 4th ed. Geneva: World Health Organization; 1996. p. 80-87. [ Links ]
6. Dean DJ, Abelseth MK, Atanasiu P. The fluorescent antibody test. In: Meslin FX, Kaplan MM, Koprowski H, editores. Laboratory Techniques in rabies. 4th ed. World Geneva: Health Organization; 1996. p. 88-95. [ Links ]
7. Orciari LA, Niezgoda M, Hanlon CA, Shaddock JH, Sanderlin JH, Yager PA, et al. Rapid clearance of SAG-2 rabies virus from dogs after oral vaccination. Vaccine 2001; 19: 4511-4518. [ Links ]
8. Macedo CI, Carnieli Jr P, Brandão PE, Rosa EST, Oliveira RN, Castilho JG, et al. Diagnosis of human rabies cases by polimerase chain reaction of neck-skin samples. Braz J Infect Dis 2006; 10: 341-345. [ Links ]
9. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999; 41: 95-98. [ Links ]
10. Kumar S, Tamura K, Jakobsen IE, Nei M. MEGA 2: molecular evolutionary genetic analysis software. In: Evolutionary Genetics Analysis Software. Tempe: Arizona State University; 2001. [ Links ]
11. Wunner WH. Rabies. In: Jackson AC, Wunner WH, editors. Rabies. San Diego: Academic Press; 2007. p.23-68. [ Links ]
12. Carnieli Junior P, Castilho JG, Fahl WO, Véras NMC, Timenetsky MCST. Genetic characterization of Rabies virus isolated from cattle between 1997 and 2002 in an epizootic area in the state of São Paulo, Brazil. Virus Res 2009; 144: 215-224. [ Links ]
13. Kobayashi Y, Sato G, Kato M, Itou T, Cunha EM, Silva MV, et al. Genetic diversity of bat rabies viruses in Brazil. Arch Virol 2007; l52: 1995-2004. [ Links ]
14. Kobayashi Y, Sato G, Shoji Y, Sato T, Itou T, Cunha EMC, et al. Molecular epidemiological analysis of bat rabies viruses in Brazil. J Vet Med Sci 2005; 67: 647-652. [ Links ]
15. Ito M, Itou T, Shoji Y, Sakai T, Ito HF, Arai TY, et al. Discrimination between dog-related and vampire bat-related rabies viruses in Brazil by strain-specific reverse transcriptase-polymerase chain reaction and restriction fragment length polymorphism analysis. J Clin Virol 2003; 26: 317-330. [ Links ]
16. Velasco-Villa A, Orciari LA, Juarez-Islas V, Gomez-Sierra M, Padilla- Medina I, Flisser A, et al. Molecular diversity of rabies viruses associated with bats in Mexico and other countries of the Americas. J Clin Microbiol 2006; 44: 1697-1710. [ Links ]
17. Kobayashi Y, Ogawa A, Sato G, Sato T, Itou T, Samara SI, et al. Geographical distribution of vampire bat-related cattle rabies in Brazil. J Vet Med Sci 2006; 68: 1097-1100. [ Links ]
18. Kobayashi Y, Sato G, Mochizuki N, Hirano S, Itou T, Carvalho AAB, et al. Molecular and geographic analyses of vampire bat-transmitted cattle rabies in central Brazil. BMC Vet Res 2008; 4: 44. [ Links ]
19. Oliveira RN. Vírus da raiva em morcegos insetívoros: implicações em epidemiologia molecular e diversidade dos genes codificadores da nucleoproteína e glicoproteína.Tese de Mestrado. São Paulo: Universidade de São Paulo; 2009. [ Links ]
Address to:
Drª Carla Isabel Macedo
Virology Department/Instituto Pasteur
Av. Paulista 393, Cerqueira Cezar
01311-000 São Paulo
Tel: 55 11 3145-3171; Fax: 55 11 3284-4924
e-mails: cmsilveira@pasteur.sp.gov.br, Cimacedo67@gmail.com
Received in 02/09/2009
Accepted in 28/01/2010
