New Delhi metallo-β-lactamase (NDM) is a β-lactamase classified as Ambler class B, and it differs from other carbapenemases because it uses zinc in its active site, which facilitates antimicrobial hydrolysis and confers resistance against all β-lactam antibiotics except aztreonam. The bla NDM-1 gene was first detected in 2009 in isolates of Klebsiella pneumoniae and Escherichia coli from the feces of a Swedish patient in India1. Since this first description, bla NDM-1 has been reported worldwide2. In South America, bla NDM-1was reported in Uruguay in a Providencia rettgeri isolate and in Brazil in the state of Rio Grande do Sul. In both countries, bla NDM-1 was reported for the first time in the same species3.
In addition to its resistance mechanisms, these K. pneumoniae isolates may present several virulence factors, those that stand out are the production of polysaccharide capsules, fimbrial adhesin type 3, and yersiniabactin. Fimbrial adhesins type 3 can mediate the binding of K. pneumoniae isolates to various human cells, such as the endothelial and epithelial cells of the respiratory tract and urinary tract4. The accumulation of virulence genes along with resistance genes may facilitate infection and limit therapeutic options.
This paper analyzes a K. pneumoniae isolate (K2-R2) from a female patient with sepsis who was admitted to the clinical medicine department of a public hospital in Recife, Brazil, on 12/04/2016. The K2-R2 isolate was pre-selected because it is involved in sepsis and is multi-drug resistant (MDR), including to carbapenems. The isolate was biochemically identified using the automated (Bactec 9120/Phoenix-BD system). The culture was preserved in 20% glycerol at -70 ºC and grown in the medium of Brain Heart Infusion (BHI) at 37 ºC for 18 hours prior to analysis. Susceptibility to several classes of antimicrobials was detected using the automated Bactec 9120 (Phoenix BD) system, and susceptibility to the following antimicrobials was tested: amikacin, ampicillin, ampicillin/sulbactam, ceftazidime, cefepime, cefoxitin, ciprofloxacin, ceftriaxone, cefuroxime, colistin, gentamycin, ertapenem, imipenem, meropenem, and tigecycline. Interpretation was performed according to the criteria of the Clinical and Laboratory Standards Institute (CLSI)5.
The genomic DNA of the K2-R2 isolate was extracted using the Wizard Genomic DNA purification kit (Promega) in accordance with the manufacturer’s instructions. The genes encoding resistance to carbapenems (bla KPC , bla VIM , bla GES , bla IMP and bla NDM), those encoding resistance to aminoglycoside (aac(3’)-Ia; aac(3’)IIa, and aac(6’)-Ib), the efflux pump gene (acrB), and the virulence genes (cps, mrkD and irp2) were investigated using the (polymerase chain reaction (PCR) technique. A description of the primers and amplification conditions utilized are presented in Table 1 6–12. Negative and positive controls were included in each PCR. The amplified products were electrophoresed in 1% agarose gel under a constant voltage of 100V in 0.5X (Tris-base boric acid (TBE) buffer and (Ethylenediamine tetra-acetic acid (EDTA).
Primer | Sequence (5`- 3`) | Temp.a | Reference | Gene |
---|---|---|---|---|
KPC1a | TGTCACTGTATCGCCGTC | 63°C | Cabral et al. (2017)6 | bla KPC |
KPC1b | CTCAGTGCTCTACAGAAAACC | |||
VIM-F | CAG ATT GCC GAT GGT GTT TGG | 64°C | Cabral et al. (2017)6 | bla VIM |
VIM-R | AGG TGG GCC ATT CAG CCA GA | |||
GES-F | ATGCGCTTCATTCACGCAC | 60°C | Bagheri-Nesami et al. (2016)7 | bla GES |
GES-R | CTATTTGTCCGTGCTCAGG | |||
IMP-F | GGA ATA GAG TGG CTT AAT TCT C | 60°C | Cabral et al. (2017)6 | bla IMP |
IMP-R | GTG ATG CGT CYC CAA YTT CAC T | |||
NDM-F | GGTTTGGCGATCTGGTTTTC | 52°C | Poirel et al. (2011)8 | bla NDM |
NDM-R | CGGAATGGCTCATCACGATC | |||
AAC(3’)-Ia-F | GACATAAGCCTGTTCGGTT | 55°C | Noppe-Leclercq et al. (1999)9 | aac(3’)-Ia |
AAC(3’)-Ia-R | CTCCGAACTCACGACCGA | |||
AAC(3’)-IIa-F | GGCAATAACGGAGGCGCTTCAAAA | 55°C | Noppe-Leclercq et al. (1999)9 | aac(3’)-IIa; |
AAC(3’)-IIa-F | TTCCAGGCATCGGCATCTCATACG | |||
AAC(6’)-Ib-F | TATGAGTGGCTAAATCGAT | 55°C | Noppe-Leclercq et al. (1999)9 | aac(6’)-Ib-cr |
AAC(6’)-Ib-R | CCCGCTTTCTCGTAGCA | |||
ACRB-F | TCAAACCAGGTGTGCAGGTA | 61°C | Scavuzzi et al. (2017)10 | acrB |
ACRB-R | TTAATACCCAGACCGGATGC | |||
CPS-F | TCCCAATTGTGACCGAAATC | 63°C | Hennequin e Forestier (2007)11 | cps |
CPS-R | GCTCGCGGCACCAGCTGA | |||
MRKD-2 F | CCA CCA ACT ATT CCC TCG AA | 58°C | Melo et al. (2014)12 | mrkD |
MRKD-2 R | ATG GAA CCC ACA TCG ACA TT | |||
IRP2 F | ATT TCT GGC GCA CCA TCT | 65°C | Melo et al. (2014)12 | irp2 |
IRP2 R | GCG CCG GGT ATT ACG GAC TTC |
The amplicons were purified using the Wizard®SV Gel and PCR Clean-Up System (Promega). After purification, they were quantified in nano-drops and sequenced (3500 Genetic Analyzer – Applied Biosystems). Sequences were analyzed using Chromas software (http://www.mybiosoftware.com/sequence-analysis) and compared to sequences deposited in the GenBank databases (http: //www.ncbi .nlm.nih.gov / blast /) using the (Basic Local Alignment Search (BLAST) tool. After the BLAST comparison, the nucleotide sequences were translated into proteins with the (Sequence Manipulation Suite (http://www.bioinformatics.org/sms2/trans_map.html) using the Translation Map tool.
The K. pneumoniae isolate exhibited resistance to multiple drugs, such as penicillin, β-lactamase inhibitors, cephalosporins, aminoglycoside, and carbapenems (Table 2), and only exhibited sensitivity to amikacin, ciprofloxacin, colistin, and tigecycline. The PCR and sequencing analyses demonstrated the presence of the resistance genes bla NDM-1 and aac(6’)-Ib-cr, the virulence genes cps and mrkD and the gene for the efflux pump acrB. The sequence of the gene bla NDM-1 was deposited into GenBank under the following accession number: MH818328. The genes bla KPC, bla VIM, bla GES, bla IMP, aac(3’)-Ia; aac(3’)IIa, and irp2 were not found.
Antimicrobial | MIC | Interpretation |
---|---|---|
µg/mL | ||
Amikacin | ≤ 2 | S |
Ampicillin | ≥ 32 | R |
Ampicillin/Sulbactam | ≥ 32 | R |
Cefepime | 8 | I |
Cefoxitin | ≥ 64 | R |
Ceftazidime | ≥ 64 | R |
Ceftriaxone | ≥ 64 | R |
Cefuroxime | ≥ 64 | R |
Ciprofloxacin | ≤ 0,25 | S |
Colistin | ≤ 0,5 | S |
Ertapenem | ≥ 8 | R |
Gentamycin | ≥ 16 | R |
Imipenem | ≥ 16 | R |
Meropenem | ≥ 16 | R |
Tigecycline | ≤ 0,5 | S |
To the best of our knowledge, this is the first report on the bla NDM-1 gene in K. pneumoniae isolate in Recife-PE, Brazil. In South America, the bla NDM-1 gene was first recorded in 2012 in Uruguay, a country bordering the Brazilian state of Rio Grande do Sul, where NDM was first described in Brazil3. The following year, Carvalho Assef et al. (2014)13 performed a retrospective study and detected six strains of Enterobacter hormaechei subsp. oharae, which are NDM producers related to the isolates recovered in 2012, prior to the first report on bla NDM-1 in Brazil. Since then, other NDM-producing Enterobacteriaceae have been isolated in the South and Southeast Regions of Brazil14.
In Northeast Brazil, Baberino et al.15 first detected bla NDM-1 in K. pneumoniae and Citrobacter freundii in 2015. The present report on a K. pneumoniae isolate harboring the bla NDM-1 gene in Recife-PE demonstrates the dispersion of this gene in the Brazilian Northeast.
The resistance profile of the K. pneumoniae isolate suggests that the high resistance to carbapenems is related to the association of more than one resistance mechanism, which was confirmed with the concomitant presence of bla NDM-1 and efflux pump AcrB. In Brazil, Scavuzzi et al.10 reported a bla KPC-2resistant to various drugs that presented alongside the co-production of the acrB gene and an efflux pump that reduces susceptibility to several drugs in K. pneumoniae isolates. This may explain the MDR resistance profile of the isolate of this study.
The co-production of bla NDM-1 with other β-lactamases or with genetic determinants related to resistance to quinolones, such as aac(6´)-Ib-cr, are also frequently detected in enterobacteria; this corroborates the findings presented in this paper2. Besides the association of bla NDM-1 and aac(6´)-Ib-cr, the presence of an efflux pump and virulence genes was also verified, which demonstrates the presence of different associated genetic mechanisms. The virulence factors detected in the K2-R2 isolate suggest that, in addition to multi-antimicrobial resistance, this bacterium exhibits important mechanisms that lead to infection, such as the potential to resist phagocytosis due to the presence of the cps gene and the ability to adhere and form biofilm on the surface of catheters due to the gene encoding type 3 fimbria (mrkD)12.
This accumulation of resistance genes in association with the efflux pump and virulence genes in K. pneumoniae limit the therapeutic options, which explains many failures in the attempts to control healthcare-associated infections (HAIs) caused by this species. The detection of bla NDM-1 in K. pneumoniae in Recife, Brazil, highlights the need to adopt urgent and rigorous effective measures to control the spread of this carbapenemase in all regions of the country. If a set of control measures is not adopted, the proliferation of bla NDM-1 will likely occur in Brazil, in the same manner as the proliferation of bla KPC-2.