INTRODUCTION
Schistosomiasis, a water-transmitted tropical disease (NTDs)-caused by trematode parasites of the genus Schistosoma-that remains largely neglected. Several parasites of this genus, such as S. haematobium, S. japonicum, S. intercalatum, S. mekongi, and S. mansoni are epidemiologically relevant and are capable of parasitizing humans. In Brazil, human schistosomiasis is caused by S. mansoni, which is responsible for the intestinal and hepatic forms of this disease1,2.
Schistosomiasis mansoni, which affects some 240 million individuals worldwide, causes a parasitic disease considered as the third most important socioeconomic and public health issue. In Brazil, schistosomiasis remains an important public health issue due to its prevalence throughout the national territory. According to the “National Survey of Prevalence of Schistosomiasis mansoni and geohelminthosis”, conducted among schoolchildren in Brazil, 14 states were found to be endemic for schistosomiasis3. Among the Brazilian states endemic for schistosomiais, Bahia has the second highest prevalence with the largest endemic area, which included 251 out of 417 municipalities, including the city of Salvador4.
The life cycle of S. mansoni is complex, and involves definitive hosts (vertebrates) and intermediate hosts (snails). Previously, transmission of schistosomiasis was found primarily in rural areas. However, intense migratory flows of people from rural endemic areas to urban areas and rapid urbanization contributes to the spreading of parasitic diseases to urban areas. Furthermore, large-scale distribution of the intermediate host-snails of the genus Biomphalaria-favors territorial expansion of this disease via the establishment of schistosomiasis transmission foci. In Brazil, 11 species and 1 subspecies of Biomphalaria have been described, of which, the following 3 are considered natural hosts of S. mansoni; B. glabrata, B. tenagophila, and B. straminea5.
The distribution of the snail vector is directly correlated with the distribution of schistosomiasis cases6. Since the snails are necessary for transmission, updated information on the distribution and characterization of the snail population is essential and contributes directly to the orientation, planning and development of surveillance as well as to the adoption of proper control measures for schistosomiasis. This study was aimed at evaluating B. glabrata populations in the water collections from the city of Salvador in order to determine their distribution, identify foci of schistosomiasis transmission to determine the prevalence of S. mansoni infection and to characterize shed cercariae.
METHODS
Study site and selection of collection points
The study was conducted in Salvador, capital of the State of Bahia, Northeastern region of Brazil (-12.9704; -38.5124); (Figure 1A). Salvador is divided into 12 regions, termed Sanitary Districts, for the purpose of public health administration. Samples were collected from 17 lentic or lotic water collection points distributed in 8 Sanitary Districts of Salvador, namely Boca do Rio, Brotas, Cabula/Beiru, Centro Histórico, Itapuã, Pau da Lima, São Caetano/Valéria and Subúrbio Ferroviário (Table 1; Figure 1B). Five of the sites were in the process of undergoing urban renewal or major construction with little community contact and were therefore eliminated from the assessment. All sites had permanent collections of water throughout the year and were at, or near, points where the human population had significant contact with the water.
TABLE 1: Characterization of collection points in the Sanitary District study sites, type of water collection and presence of vegetation.
| Sanitary District | Point | Study Site | Classification |
|---|---|---|---|
| Boca do Rio | 1 | Parque Pituaçu | Stream |
| 2 | Bate Facho | Stream | |
| Brotas | 3 | Dique do Tororó | Dike |
| 4 | Avenida ACM | Ditch | |
| Cabula/Beiru | 5 | Alameda Flamengo | Lagoon |
| 6 | Horta Saramandaia | Vegetable garden channel | |
| Centro Histórico | 7 | Rua Nossa Senhora de Lourdes | Stream |
| Itapuã | 8 | Lagoa do Abaeté | Lagoon |
| Pau da Lima | 9 | Lagoa do Urubu | Lagoon |
| 10 | Lagoa do IAT | Lagoon | |
| São Caetano/Valéria | 11 | Rua São Rafael | NA |
| 12 | Horta São Bartolomeu | Vegetable garden channel | |
| 13 | Rua das Fontes | NA | |
| 14 | Rio do Cobre | River | |
| 15 | Dique do Cabrito | Dike | |
| Subúrbio Ferroviário | 16 | Rua Gevársio Cerqueira | Vegetable garden channel |
| 17 | Rua Ray Charles | NA |
Malacological survey and mollusk maintenance
The malacological surveys were conducted between June and December of 2017, in accordance with the technique described by Oliver and Schneiderman7. The density of collected snails was made by dividing the number of planorbids collected at each point by the number of collectors that collected in the 10-minute period. The snails were transported to the Gonçalo Moniz Institute (IGM-FIOCRUZ) and kept in glass aquaria with dechlorinated water. The snails were fed on alternate days with thoroughly washed fresh lettuce.
Natural infection survey and snail identification
Snails were placed individually in jars containing 4 mL of filtered, dechlorinated tap water. Screening for S. mansoni cercariae and other larval trematodes was carried out via weekly exposure to light (60W/4 hours) over a period of 4 weeks. Snails remaining negative at the end of this period, were analyzed for another 10 d. Positive snails were examined using a stereoscopic microscope, and live cercariae were stained with 5% lugol. Cercarial types were identified according to the criteria established by Alves Pinto and Lane de Melo8. Shell crushing was not perfomed because the soft body portion of Biomphalaria glabrata was required for morphological identification of the species. All snails were morphologically identified according to Paraense9.
PCR analysis
The prevalence of S. mansoni infection in a randomly selected sub-group of snails was evaluated via real time polymerase chain reaction (qPCR). DNA extraction from snails was conducted using a DNeasy® Blood and Tissue Kit (QIAGEN®, Germany), following the manufacturer’s instructions. S. mansoni-specific primers were used to amplify the 18S rRNA subunit as follows: Schfo 111 (5’ – CGATCAGGACCAGTGTTCAGC – 3’) and Schre 111 (5’ – GACAGGTCAACAAGACGAACTCG – 3’), as described by Gomes10and qPCR was carried out on an ABI PRISM 7000 system (Applied Biosystem, CA, US). The total qPCR reaction volume of 25 µL consisted of 7.5 µL H2O, 12.5 µL Syber Green, 2 µL of the two amplification primer, 1 µL ROX and 2 µL of template DNA. PCR was performed under the following cycles: 50ºC for 2 min, followed by 40 cycles of amplification (95ºC for 2 min, 95ºC for 15 s, and 60ºC for 30 s). Negative controls were used for each reaction, and a standard curve was constructed using a sample of S. mansoni DNA isolated from worms. All reactions were performed in duplicate. ABI PRISM software (version 1.1) was used for the analysis and interpretation of results.
RESULTS
General distribution of Biomphalaria glabrata
A total of 1,403 B. glabrata, the only vector species found in this study, were collected from 12 water collections (Table 2). Of these, 730 snails survived at the end of 40 d of malacological analyzes, representing a survival rate of 52%. These snails were morphologically identified and submitted for DNA extraction. The highest snail survival rate, that of 69% survivors, was observed in the water collections of Dique do Cabrito and Lagoa do Urubu (Table 2).
TABLE 2: Total B. glabrata counts per water collection, amount, and percentage (%) of alive snails after 40 days of laboratory maintenance.
| Sanitary District | Collection Site | Collected Snails | Live Snails after 40 days |
|---|---|---|---|
| Boca do Rio | Parque Pituaçu | 294 | 145 (49%) |
| Bate Facho | 22 | 13 (59%) | |
| Brotas | Dique do Tororó | 3 | 2 (66%) |
| Avenida ACM | 84 | 48 (57%) | |
| Cabula/Beiru | Alameda Flamengo | 0 | 0 |
| Horta Saramandaia | 410 | 205 (50%) | |
| Centro Histórico | Rua Nossa Senhora de Lourdes | 49 | 27 (55%) |
| Itapuã | Lagoa do Abaeté | 0 | 0 |
| Pau da Lima | Lagoa do Urubu | 42 | 29 (69%) |
| Lagoa do IAT | 33 | 18 (54%) | |
| São Caetano/Valéria | Rua São Rafael | 0 | 0 |
| Horta São Bartolomeu | 289 | 144 (49%) | |
| Rua das Fontes | – | – | |
| Rio do Cobre | 58 | 28 (48%) | |
| Dique do Cabrito | 33 | 23 (69%) | |
| Subúrbio Ferroviário | Rua Gevársio Cerqueira | 86 | 48 (56%) |
| Rua Ray Charles | 0 | 0 | |
| Total | 1403 | 730 |
B. glabrata was found to be distributed in 8 Sanitary Districts of the city of Salvador. In the Sanitary District of Cabula/Beiru, in particular, where the Horta de Saramandaia is located, 410 snails were collected. In the Boca do Rio Sanitary District, where Parque Pituaçu is located, a total of 294 snails were collected, and in the São Caetano/Valéria Sanitary District, 289 snails were collected in Horta de São Bartolomeu.
Larvae of trematodes found in B. glabrata
Of the 730 snails that survived parasitological analyses, 5 snails shed S. mansoni cercariae (Figure 2A). Notably, 25 snails shed only non-Schistosoma larvae as follows: Xihphidioceraria (Figure 2B1-3); Strigeidae (Figure 2E), Spirorchiidae (Figure 2D), and Clinostomatoide (Figure 2C).
FIGURE 2: Larvae of trematodes found in B. glabrata. (A): S. mansoni Cercariae; (B): Xiphidiocercaria: (B1): Lutzi Cercariae; (B2,3): Santense Cercariae; (C): Clinostomidae, (D): Spirorchiidae (E): Strigeidae.
S. mansoni cercariae were found only in 2 water collections: the Lagoa do IAT, in the Sanitary District of Pau da Lima; and Horta de Saramandaia, located in the Sanitary District of Cabula/Beiru, which were 5.5% and 1.9% positive, respectively. Additionally, in Horta de Saramandaia, 4.3% snails shed Xiphidiocercaria. In Dique do Cabrito, 1 snail shed Clinostomidae cercariae and 1 snail shed Spirorchiidae cercariae. Positivity rate in both cases was 4.3%. The highest positivity was observed in Lagoa do Urubu, with 31% of snails shedding Strigeidae cercariae (Table 3).
TABLE 3: Cercarian types found in specimens of Biomphalaria glabrata in the water collections of Salvador.
| Sanitary District | Water Collection | Positive Snails | Cercarial Types | Positivity (%) |
|---|---|---|---|---|
| Cabula/Beiru | Horta de Saramandaia | 4/205 | S. mansoni | 1.9% |
| 9/205 | Xiphidiocercaria | 4.3% | ||
| Pau da Lima | Lagoa do Urubu | 9/29 | Strigeidae | 31% |
| Lagoa do IAT | 1/18 | S. mansoni | 5.5% | |
| São Caetano/Valéria | Dique do Cabrito | 1/23 | Spirorchiidae | 4.3% |
| 1/23 | Clinostomidae | 4.3% |
Molecular detection of S. mansoni
Of the 1403 snails collected, 626 were used for molecular detection of S. mansoni via qPCR. Only product amplifications with a melting temperature equal to that of the positive control, Ct < 35, and a correlation coefficient (r2) of 0.99 were considered positive. All negative controls were negative in all experiments. The sensitivity of qPCR for detection of S. mansoni infections was 100% while specificity was 94.5% compared with the results of the light exposure method.
Of the 626 samples, 39 were considered positive, representing a positivity of 6.2%. Of these, only 5 (0.8%) were positive by the light exposure method. No snails that had eliminated other cercarial types were found to be positive for S. mansoni via qPCR, while none of the snails were found to be infected with 2 species of cercariae.
Among the 12 water collections containing B. glabrata, 5 (41.7%) were positive for S. mansoni only, via qPCR as follows: Parque Pituaçu, Avenida ACM, Rua Nossa Senhora de Lourdes, Horta de São Bartolomeu and Dique do Cabrito. The highest positivity via qPCR was observed in the water collection of the Dique do Cabrito, followed by Av. ACM, Lagoa do IAT and Rua Nossa Senhora de Lourdes.
Water collections that were previously determined to be positive for S. mansoni, via light exposure, were found to be even more positive for S. mansoni via qPCR. In Lagoa do IAT, only 5.5% of snails were found to be positive via the light exposure method, whereas 16.6% were found to be positive via qPCR. Similarly, the water collection of Horta de Saramandaia, which indicated a 1.9% positivity via the light exposure method, showed a positivity of 4.8% via qPCR (Table 4).
TABLE 4: Infection Rates obtained via qPCR and light exposure methods in surviving B. glabrata samples.
| Sanitary District | Collection Site | B. glabrata | Infection Rate | ||
|---|---|---|---|---|---|
| Light Exposure Method | qPCR (+) | ||||
| S. mansoni | Outros | ||||
| Boca do Rio | Parque Pituaçu | 100 | ─ | ─ | 5 (5%) |
| Bate Facho | 13 | ─ | ─ | ─ | |
| Brotas | Dique do Tororó | 2 | ─ | ─ | ─ |
| Av. ACM | 48 | ─ | ─ | 9 (18,7%) | |
| Cabula/Beiru | Horta Saramandaia | 145 | 4 (1,9%) | 9 (4,3%) | 7 (4,8%) |
| Centro Histórico | R. N. Senhora de Lourdes | 28 | ─ | ─ | 3 (10,7%) |
| Pau da Lima | Lagoa do Urubu | 29 | ─ | 9 (31%) | ─ |
| Lagoa do IAT | 18 | 1 (5,5%) | ─ | 3 (16,6%) | |
| São Caetano/Valéria | Horta São Bartolomeu | 100 | ─ | ─ | 2 (2%) |
| Rio do Cobre | 28 | ─ | ─ | ─ | |
| Dique do Cabrito | 23 | ─ | 2 (8,6%) | 10 (43,4%) | |
| Subúrbio Ferroviário | R. Gevársio Cerqueira | 48 | ─ | ─ | ─ |
| Total | 626 | 5 | 20 | 39 | |
DISCUSSION
The malacological survey, conducted by the current study, demonstrated that B. glabrata was present in 70.6% of the water collections examined. Most snails were present in streams and ditches, which together represented 50% of the water collections sampled.
The highest concentration of B. glabrata was observed in the water collections of Horta de Saramandaia and Horta de São Bartolomeu. “Horta is Portuguese for “garden”, which in Salvador often implies a large area under cultivation for local and commercial production. Although Biomphalaria snails are commonly found in natural water collections, highest population densities are usually observed in artificial breeding sites such as drainage and irrigation ditches associated with human activity11. Constant irrigation of vegetable gardens provides ideal breeding grounds for Biomphalaria spp12.
Only the water collections from Horta de Saramandaia and Lagoa do IAT were found to be positive for S. mansoni via the light exposure method after 30 d, with infection rates of 1.9% and 5.5%, respectively. Given the conditions governing cultivation and irrigation in Horta de Saramandaia, the findings from that location were expected. The presence of channels excavated for irrigation of vegetables, compounded by precarious sanitary conditions of the neighborhood and the high population density of B. glabrata, provide the necessary environment for maintaining the life cycle of S. mansoni at this site. Furthermore, in 2015, the Zoonoses Control Center (CCZ), identified B. glabrata specimens which shed S. mansoni cercariae. In the Lagoa do IAT region, similar conditions that were favorable for maintaining the S. mansoni life cycle, such as residential sewage flushed directly into the water collection and residents living with schistosomiasis, were observed.
The qPCR confirmed that all water collections found to be positive via the light exposure method, were also positive via S. mansoni DNA. Furthermore, classical methods combined with PCR were able to detect higher levels of infection prevalence. These findings were corroborated by the results of previous studies. Jannotti-Passos and Souza13 used LS-PCR in association with light exposure to determine the prevalence of S. mansoni infection following 7 and 42 d exposure of B. straminea and B. tenagophila to miracidia. Although other studies evaluated infections in other species of Biomphalaria, using different PCR techniques, their results corroborate those found in the current study, since apparent infection prevalence increased from 20% to 55% in B. straminea, and from 45% to 67.6% in B. tenagophila.
Positivity for S. mansoni seen via PCR and the absence of cercarian elimination may be explained away as being due to snail immune system activity. Non-successful infections, which do not lead to the elimination of cercariae, are detected by PCR, because parasite DNA is not completely degraded14. This phenomenon may also be explained by the fact that some primary sporocysts either degenerate or are encapsulated by hemocytes, leading to unsuccessful infections. Thus, sporocysts play a fundamental role in disease progression, since the production levels of cercariae are directly associated with the development and concentration of sporocysts in the snail15.
Moreover, late development of the immune response to S. mansoni may lead to a delay in cercarian release. Significant tissue changes which occur in infected Biomphalaria prevent the elimination of cercariae. Focal and diffuse proliferation of hemocytes accompanied by an expansion of the extracellular matrix in a manner similar to that seen in granulomas, was observed in B. glabrata16. Lemos and Andrade17proposed that these tissue changes may develop gradually in infected snails that had previously eliminated cercariae. However, these tissue changes do not guarantee complete eradication of the infection, since some sporocysts that remain may be able to complete the development cycle of the parasite, whereby cercariae may be released at any time within 9 months following infection16.
Late release of cercariae may also occur due to reproduction between susceptible and resistant snails, which influences the timing of S. mansoni development in the snail. A study of B. glabrata, generated by crossing resistant and susceptible species, reported that descending snails exhibited a delayed pre-patent phase, which could last up to 10 months18. Additionally, such late releases may also be related to sporocytogenesis19. Jourdane and Théron observed that changes that compromise the production of cercariae, such as secondary sporocyst migration to ectopic regions (cephalopodal region and kidney), may occur during sporocystogenesis20. This phenomenon has been observed in partially resistant B. glabrata, with delays in the release of cercariae up to 7 months21.
To our knowledge, this is the first record of other cercarian types, such as Strigeidae, Clinostomidae and Spirorchiidae, in the city of Salvador. Alves Pinto and Lane de Melo reported the presence of Spirorchiidae and Clinostomidae cercariae in the 3 schistosomiasis transmitter species in the state of Minas Gerais7. Clinostomidae cercariae are considered to be parasites of the oral cavity of birds, but accidental human infections have been reported22. Strigeidae cercariae have also been identified in the States of Maranhão, Minas Gerais and Rio de Janeiro23–25.
The presence of B. glabrata shedding Xifidiocercariae was observed in the water collections of Subúrbio Ferroviário in Salvador by the CCZ in 2017. Previous studies have already evaluated the presence of this cercarian type in Biomphalaria spp. from other sites26–27. This cercarian type, which has not been found to be responsible for any clinically important disease, has been considered as a source of biological control for mosquito larvae28.
The absence of coinfection in snails that were observed in this study may be due to cercarian antagonism, which leads to competition between larvae of different trematodes and results in a reduction in the number of parasites able to complete development. However, simultaneous elimination of cercariae during coinfections have been observed in S. mansoni and Cercaria lutzi coinfections exclusively in B. tenagophila24.
B. glabrata was not found in the water collections of Alameda Flamengo, Lagoa do Abaeté, Rua São Rafael, Rua das Fontes and Rua Ray Charles. Three of these locations were undergoing major public construction work, such as sanitary sewer placement or street paving. Considering that parasitic diseases reflect sanitary conditions as well as hygiene habits of a population, these results demonstrated that effective public interventions is fundamental for improving living conditions as well as for preventing and regulating parasitic diseases29.
A limitation of this study was the reduction of snail survival rates during weekly malacological analyses that lasted 30 d. This suggests that the duration of the analysis may have influenced B. glabrata survival, as it is possible that snails that did not survive were parasitized by S. mansoni, may have had different susceptibility profiles or differences in the amount of miracidia penetrated30.
In the future, we hope to assess more water collections in the city of Salvador, in order to evaluate infections in snails using a combination of conventional and molecular techniques. An additional goal is to evaluate resistance and susceptibility profiles of these snails.
Our results indicate that B. glabrata is widely distributed in the city of Salvador, and 7 of its water collections carry a risk of schistosomiasis transmission. In addition, we propose that qPCR may be utilized to evaluate S. mansoni infections in B. glabrata during the pre-patent phase. It is evident that estimating S. mansoni prevalence in snails by taking only the light exposure method classical into account may underestimate the issue. To the best of our knowledge this is the first study of B. glabrata eliminating Clinostomidae, Strigeidae, and Spirorchiidae cercariae in Salvador.
