INTRODUCTION
Chagas disease (CD) is an anthropozoonosis caused by the protozoan Trypanosoma cruzi and is typically transmitted by triatomines, vectors of the Triatominae family (Hemiptera: Reduviidae), known as kissing bugs1–3.
In Brazil, the triatomine species responsible for CD transmission show wide spatial distribution and invasive potential, by adapting to homes and surrounding areas4. Vector presence can also be facilitated by constant alterations to the natural environment, caused by anthropic activities, leading to imbalances in ecosystems and modification of the behavior of insect vectors and wild animals that then enter homes for shelter and food5,6.
Domestic animals, especially dogs, have an important epidemiological role, because they serve as a link between domestic and wild cycles of T. cruzi7,8. Furthermore, they are an important disease sentinel, as their infection rates may reveal the potential of disease transmission to humans9–12.
However, for a better comprehension of the epidemiology of CD, the whole cycle, including vectors, must be assessed. Therefore, identifying the vector species and infection type is crucial to understanding the biology and behavior and to evaluating the risk of disease transmission to humans and domestic animals4,13. An important tool used in epidemiological studies of vector-borne diseases is the mapping of the vector’s spatial distribution, allowing for the prediction of T. cruzi transmissibility between triatomine species from spatial data14.
Thus, this study aimed to gather data on animals in a rural area of Northeastern Brazil, as well as to map and investigate natural infection by T. cruzi in triatomines. The study also aimed to detect the presence of anti-T. cruzi antibodies in dogs in order to evaluate a possible association between infected dogs and the presence of triatomines infected by T. cruzi. and to determine environment-related factors.
METHODS
Study area and sample definition
The research was conducted in the rural area of Mossoró, located in the countryside of Rio Grande do Norte, Northeast region of Brazil. According to the State Department of Public Health, this area is considered endemic,because it presents a favorable environment for the vector’s survival, due to the proximity of forests and a city dump, as well as an accumulation of debris and organic matter from animal husbandry. A total of 11 rural areas with environmental indicators for the occurrence of triatomines and a history of vector capture between 2008 and 2012, according to the Municipal Health Surveillance Department, were used in this study.
Ethical considerations
All of the 392 residences in these areas were visited between March and July 2014, and informed consent forms were obtained from residents that agreed to participate.
The project was approved by the Ethics Committee on Animal Use of the Federal Rural University of the Semi-Arid (Universidade Federal Rural do Semi-Árido) (Ruling 62/2012 – Process 23091.002190/2012-75).
Active entomologic collection
The entomological collection consisted of a system of notification and collection by the residents of triatomines in their homes. Therefore, this method allowed for the monitoring of infestations by the local community.
Samples of different species of triatomines were presented to the residents to facilitate the recognition and capture of the insects, and they were given a polyethylene bottle containing holes in the lid to store the insects. After capture, the insects were sent to the Oswaldo Cruz Foundation Institute in Rio de Janeiro (FIOCRUZ-RJ), in a specific shipment for biological samples with a deadline of 24 hours, paid for by the institute. Upon receipt, the samples were immediately processed.
Vector identification
Properly packed triatomines were sent to the Laboratory of Leishmaniosis Transmitters of the Forensic Entomology Sector of the FIOCRUZ/RJ and identified by observing their external morphological characters, using the dichotomous key according to Lent & Wygodzinsky15.
Detection of natural infection by T. cruzi
In order to detect T. cruzi infection, the intestinal contents of the insects were obtained by abdominal compression and processed for parasite isolation culture and polymerase chain reaction (PCR) techniques in the Laboratory of Immunomodulation and Protozoology of FIOCRUZ/RJ.
For the isolation, the obtained contents were seeded in tubes containing biphasic Novy-MacNeal-Nicolle + Liver Infusion Tryptose culture medium, supplemented with 10% fetal bovine serum and penicillin (10,000U/mL). The tubes were kept in an incubator (FANEM, model 347) at 27°C, and the cultures were examined weekly for four months by light microscopy using an Axioplan 2 (Zeiss®) light microscope to verify positivity.
To detect T. cruzi deoxyribonucleic acid (DNA), phenol-chloroform extraction was used to obtain DNA16, which was then subjected to a PCR with specific primers for T. cruzi (5’ ASTCGGCTGATCGTTTTCGA 3’ and 5’ AATTCCTCCAAGCAGCGGATA 3’)17. The reaction was performed in a Step One Plus™ Real-Time PCR System, using a rapid protocol of 20 seconds at 95°C followed by 40 cycles of 3 seconds at 95°C and 30 seconds at 60°C. Ultrapure water was used as the negative control, and DNA obtained from axenic culture of the T. cruzi strain Y was used as the positive control. The amplified products were subjected to agarose gel electrophoresis at 1.5% and stained with GelRed™ (Biotium), using TBE 1x buffer as an electric conductor.
Anti-T. cruzi antibody evaluation in domestic dogs
Blood samples from 218 domestic dogs were collected and, after centrifugation, the serum samples were stored in tubes and packed at -20°C until the performance of the enzyme-linked immunosorbent assays (ELISA) and indirect immunofluorescence assays (IIF) at the Laboratory of Immunomodulation and Protozoology of FIOCRUZ/RJ.
For the anti-T. cruzi immunoglobulin G (IgG) antibody assay by IIF, immunofluorescent microscope slides with total T. cruzi antigen were produced in the Laboratory of Trypanosomatid Biology of FIOCRUZ/RJ. Previously tested positive canine serum and serum of dogs from non-endemic areas were used as positive and negative controls, respectively18. An anti-dog IgG (FITC, Sigma™) was used as the conjugate. Serums with titration ≤1:20 were considered positive19.
A commercial kit produced by Bio-Manguinhos/FIOCRUZ and the anti-dog IgG conjugate (Peroxidase, Sigma™) were used for the ELISA. Samples were considered seropositive when they showed an optical density (OD) greater than the cut line (cut-off) obtained in each reaction.
As recommended by the World Health Organization for the diagnosis of human CD, samples were only considered positive when they reacted in both serological tests.
Data analysis
The data for the statistical analysis were obtained from the identification form of the dogs, the serology results of the dogs’ blood samples, and the presence of natural infection by T. cruzi in triatomine vectors.
To validate the serological tests, IIF test results were compared with those of a standard test. The analysis of agreement data was based on the sensitivity and specificity, using the statistical program GraphPad Prism version 6.01. The ELISA technique was used as the gold standard20,21.
Data were entered into an electronic spreadsheet and transferred to the statistical programs SPSS 21.0 (Statistical Package for the Social Sciences) and STATA (Stata Corp., College Station, Estados Unidos) version 13.0, expressed in simple frequency and percentage, as well as prevalence ratio (PR) and confidence interval of 95%, obtained by Poisson regression. A significance level of 5% was considered.
Mapping of triatomine capture areas
The spatial distribution of the triatomines was established from geographic coordinates (latitude and longitude) of the capture sites, using a Global Positioning System (GPS) – Garmin e Trex® in the Universal Transverse Mercator (UTM) coordinate system, using the WGS-84 (or SIRGAS 2000). The free software Quantum GIS 2.8.3 was used to prepare a thematic map of the study area.
RESULTS
The study involved 279 residences, as described in Table 1, and insects were captured in 23 of them. A total of 68 triatomines were acquired, involving 54 from inside the residences and 14 from the peridomiciliary areas. In the residences in the study, 135 of them had one or more dogs, and blood samples were obtained from all 218 dogs present.
TABLE 1: Trypanosoma cruzi evaluation, identification of triatomines, and anti-T. cruzi antibody results in dogs from rural localities in the City of Mossoró, Rio Grande do Norte.
| Rural locality/ | Total number of residences/ | Total number of dogs/ | |
|---|---|---|---|
| Geographic coordinates | Number of infected residences/ | Triatomine species identified | Number of residences with |
| Residences with infected triatomines | dogs/Residences with seropositive dogs | ||
| Settlement Sussuarana | 84/6/0 | Nymph | 38/28/6 |
| 5º09’43.9’’S | T. brasiliensis | ||
| 37º13’23.8”W | T. pseudomaculata | ||
| Sítio Umari | 2/2/1 | Nymph | 7/2/0 |
| 5°07’52.8’’S | T brasiliensis | ||
| 37°15’43.8’’W | |||
| Sítio Sombra Grande | 4/0/0 | – | 6/3/0 |
| 5º06’17.5’’S | |||
| 37º10’02.1’’W | |||
| Settlement Melancias | 6/4/1 | Nymph | 6/4/0 |
| 5º11’52.6’’S | T. brasiliensis | ||
| 37º14’09.7’’W | T. pseudomaculata | ||
| Rhodnius nasutus | |||
| Passagem de Oiticica5º14’48.5’’S | – | 0 | |
| 37º21’25.7’’W | 1/0/0 | ||
| Settlement Laginha | 1/0/0 | – | 3/1/0 |
| 5º15’14.2’’S | |||
| 37º21’33.7’’W | |||
| Sítio Canto da Farinha | 1/1/1 | Nymph | 2/1/0 |
| 5º22’16.1’’S | |||
| 37º18’39.6’’W | |||
| Settlement Lorena | 28/3/1 | T. brasiliensis | 27/17/1 |
| 5º17’17.2’’S | |||
| 37º20’03.2’’W | |||
| Sítio Barbadinho | 3/1/1 | Nymph | 4/3/0 |
| 5º22’03.8’’S | |||
| 37º18’32.6’’W | |||
| Settlement Espinheirinho | 43/3/1 | Nymph | 58/32/6 |
| 5º26’15.0’’S | T. brasiliensis | ||
| 37º11’58.8’’W | Panstrongylyus lutzi | ||
| Settlement Passagem de Pedra | 106/3/0 | T. brasiliensis | 67/44/12 |
| 5º09’23.9’’S | |||
| 37º17’01.1’’W | |||
| Total | 279/23/6 | 118/135/25 |
The captured triatomines corresponded to 25 nymphs of undetermined stage, and 43 adults, identified as 69.7% (30/43) Triatoma brasiliensis brasiliensis (Neiva 1911), 23.2% (10/43) Triatoma pseudomaculata (Corrêa and Espínola 1964), 4.6% (2/43) Rhodnius nasutus (Stal 1895), and 2.3% (1/43) Panstrongylus lutzi (Neiva and Pinto 1923). The distribution of these species in the 11 rural localities is shown in Table 1. Of the 68 captured specimens, 51 (75%) were under suitable conditions to obtain intestinal contents for T. cruzi analysis by isolation culture and PCR, including 24 adult specimens of T. b. brasilensis, one of T. pseudomaculata, one of R. nasutus,and 25 nymphs. Attempts to isolate T. cruzi by culture were negative in all triatomines, but 41.1% (21/51) of the samples were positive on PCR.
The results of the serological testing for T. cruzi showed that 11% (25/218) of the dogs tested were seropositive for both tests (ELISA and IIF). The sensitivity of the test was 53.2%, and the specificity was 99.4%, with confidence intervals of 38.1 – 67.9 and 96.8 – 99.0, respectively.
There was no association between the serologic results of the dogs and the presence and infection by T. cruzi in triatomines. The same was observed for dog-related factors, such as gender, role, and the presence of shelter or other animals (Table 2).
TABLE 2: Prevalence of the variables function, gender, presence of shelter, presence of other animals, and presence and infection by T. cruzi in triatomines with seropositive dogs for Chagas disease in rural areas.
| Variable | Total number of dogs | Prevalence of seropositive dogs (%) | PR | 95%CI |
|---|---|---|---|---|
| Vector presence | ||||
| yes | 18 | 1 (5.6) | 0.27 | 0.04 – 1.86 |
| no | 116 | 24 (20.7) | 1 | |
| Vector infected by T. cruzi | ||||
| yes | 03 | 0 (0.0) | – | – |
| no | 131 | 25 (19.1) | 1 | |
| Male dogs | ||||
| yes | 104 | 18 (17.3) | 0.74 | 0.34 – 1.61 |
| no | 30 | 07 (23.3) | 1 | |
| Dog function: companion | ||||
| yes | 50 | 13 (26.0) | 1.82 | 0.90 – 3.67 |
| no | 84 | 12 (14.3) | 1 | |
| Dogs function: guard | ||||
| yes | 80 | 13 (16.3) | 0.73 | 0.36 – 1.47 |
| no | 54 | 12 (22.2) | 1 | |
| Dogs function: hunting | ||||
| yes | 21 | 4 (19.0) | 1.02 | 0.39 – 2.68 |
| no | 113 | 21 (18.6) | 1 | |
| Own shelter | ||||
| yes | 33 | 8 (24.2) | 1.44 | 0.68 – 3.03 |
| no | 101 | 17 (16.8) | 1 | |
| Number of dogs in residence | ||||
| one | 79 | 12 (15.2) | 0.64 | 0.32 – 1.30 |
| more than one | 55 | 13 (23.6) | 1 | |
| Presence of production animals | ||||
| yes | 69 | 13 (18.8) | 1.02 | 0.50 – 2.07 |
| no | 65 | 12 (18.5) | 1 | |
| Presence of domestic animals | ||||
| yes | 100 | 22 (22.0) | 2.49 | 0.80 – 7.81 |
| no | 34 | 3 (8.8) | 1 | |
| Presence of wild animals | ||||
| yes | 15 | 3 (20.0) | 1.08 | 0.37 – 3.19 |
| no | 119 | 22 (18.5) | 1 |
Triatomines were present in eight of the eleven rural localities included in this study, as shown in Figure 1.
DISCUSSION
The transmission of CD is undoubtedly influenced by socio-cultural, political, economic, environmental, and historical factors22, because the occurrence of this disease reflects how the population occupies and explores the environment in which it lives23. Studies have shown that information about the vectors of CD in endemic areas is lacking, leading to the inefficiency of intervention programs24. Control programs of these areas should focus on educational measures adapted to the local context, elucidating the importance of the capture of the vectors and notification of the authorities to control the disease25.
The species found in this study are also distributed in other states of Brazil4,26; however, the Northeast Region of Brazil is considered the epicenter of dispersion of T. brasiliensis and T. pseudomaculata27. Geographical distribution of R. nasutus and P. lutz is restricted to certain regions of the Northeast region28, and both species are considered secondary vectors for T. cruzi transmission. However, research in Colombia has shown the relevance of these species, demonstrating that 59.4% of the secondary vectors had humans as the main food source29.
Studies have demonstrated that T. brasiliensis is the most important T. cruzi vector in Northeastern Brazil, with a high rate of infection30,31. This fact is attributed to the adaptability of this species to the hot and dry climate conditions of the Northeast region, where it only rains a few months out of the year32. This species of triatomine has high adaptability to a human habitat, corroborating the present study, which noted household and peridomiciliary presence of the same species. T. brasiliensis is classified as a domestic species due to the household presence of adults, nymphs, eggs, and molt32. This adaptability to the home area can also restrict its access to domestic and synanthropic animals as a food source33. Therefore, T. cruzi infection in these vectors may be crucial for the establishment of infection in humans and domestic animals.
Triatoma pseudomaculata is also important for the epidemiological surveillance of CD, since it’s the most frequent species after T. brasiliensis27,34. This species often shelters itself in locations of the residence that receive more sunlight, such as the rooftop30, and is well suited to the high temperatures observed in the study area35.
Regarding the testing for the presence of T. cruzi in triatomines, the negative results in the culture isolation may be associated with absence of viable parasites in inoculated samples, which is linked to the handling difficulty and death of the insects36, the contamination of the culture medium inhibiting the growth of the parasite, and the possibility that some strains of T. cruzi have a poor growth in culture37. However, infection of triatomines was confirmed by the detection of T. cruzi DNA by PCR in 41.17% of the samples. Therefore, we do not recommend the use of the isolation technique in culture to investigate the presence of T. cruzi in samples from the intestinal tract of insects.
The variation in the rate of infection by T. cruzi in this study may be associated with the dominant vector in each region, since each triatomine genera has a preference to certain natural or artificial ecotypes30,38, which may make them more susceptible to infection. For example, Coutinho et al.30 observed that there is greater natural infection by T. cruzi in triatomines housed in wood piles, because these sites function as burrows of small animals, such as rodents and marsupials, that are wild reservoirs of T. cruzi. These animals then have a high capacity to infect the vectors38, while dogs, cats, and humans show much less infectivity to triatomines39.
The present study utilized serologic tests for canine CD diagnosis because, although the primary infection with T. cruzi includes an initial phase with high parasitemia, this phase lasts a short time21,40, whereas T. cruziantibodies persist at detectable levels for a long time39,41. Nevertheless, no serologic test is currently considered the gold standard for CD, so the use of both ELISA and IIF for the diagnosis allows the obtainment of a reliable serology result42. The variation in the concordance between serologic tests may occur due to the incidence of reactivity between closely related trypanosomes, such as Trypanosoma rangeli and Leishmania spp.12,43.
The seropositivity of dogs in this study (11.5%) was lower than that found in areas with the presence of triatomine vectors known to be infected, such Colombia, where 71.6% of dogs were seropositive through ELISA and IIF techniques, and the State of Ceará, Brazil, where Bezerra et al. found 38% seropositivity using the same tests44. However, similar results to this study were observed in Peru, where the seropositivity in dogs was 12.3% by ELISA and TESA-blot techniques, and the main vector for the parasite identified in the region was Triatoma infestans45. In the State of Piauí, Brazil, the seropositivity obtained by ELISA and IIF was 7.7%, with the species T. brasiliensis reported as the main vector46, as in the present study. The difference in seropositivity between the studies may be associated with the abundance of certain vector species in each region, based on ideal climatic, environmental, and geographic conditions for the survival and reproduction of each species47. Thus, the triatomine species, the T. cruzi prevalence, and the behavior of the dogs are factors that may influence the risk of infection in dogs48.
In regards to seropositivity in dogs, the health status of the dogs, due to poor nutrition and immunosuppression, may be directly reflected in the antibody levels39,40. Therefore, the differences between regions need to be considered when evaluating the transmission cycle of T. cruzi in home areas, since socioeconomic indexes and infection risks are directly related49.
No relation between the presence of seropositive dogs and that of infected triatomine vectors was observed in this study (Table 2). These factors cannot be discarded, however, since the domiciliation of triatomines and the circulation of T. cruzi between humans and domestic and wild animals are crucial to the establishment of infection. The availability of domestic hosts in households may directly affect the vector’s choice of food source, reducing human-vector contact rates and transmission of the parasite50.
The mapping of vectors (Figure 1) allows the spatial observation of areas with T. cruzi infection and helps the local health services in the control and surveillance of these areas14. Geoprocessing techniques have been widely used to understand epidemiological aspects of CD vectors, including characterization of the areas where the disease is present51–53 and the relation between its distribution and reservoirs29,34. This reinforces the importance of the data observed in this study.
The spatial arrangement of triatomines reaffirms the presence of CD vectors in the environment in some rural areas and confirms the presence of natural infection by T. cruzi in these insects, along with diagnosing seropositive dogs. Although no association between seropositive dogs and the presence and infection of triatomine vectors was found, a domestic cycle of the disease is still possible. These results emphasize the importance of epidemiologic monitoring and surveillance of CD, since the health of domestic animals, especially dogs, and their close relationship with humans reflect the health and the level of exposure of local residents to the vector.
